http://www.med.uni-muenchen.de/biochemie/zachau/kappa.htm
The immunoglobulin k genes and the k locus of the mouse
The data of our laboratory on the genes and the locus are described in the following reports:
(a) T. Kirschbaum et al., 1998. The 3’ part of the locus...; Eur. J. Immunol. 1998. 28: 1458 - 1466
In the following data are reported,
which supplement the printed reports.
Previous publications from our laboratory,
see 'List of publications'.
Further information can be obtained from Zachau@bio.med.uni-muenchen.de.
(a) Kirschbaum, T., Pourrajabi, S., Zocher, I., Schwendinger, J., Heim, V., Röschenthaler, F., Kirschbaum, V. and Zachau, H.G.,
The 3’ part of the immunoglobulin k locus of the mouse. Eur. J. Immunol. 1998. 28: 1458 - 1466.
(b) Kirschbaum, T., Röschenthaler, F., Bensch, A., Hölscher, B., Lautner-Rieske, A., Ohnrich, M., Pourrajabi, S., Schwendinger, J., Zocher, I. and Zachau, H. G.
The central part of the mouse immunoglobulin k locus. Eur. J. Immunol. 1999, 29:2057-2064.
ABSTRACT
At the present state of analysis the central part of the k locus comprises four contigs of
together 1.2 Mb and contains 55 Vk genes. It is flanked by the 3’ part of the locus with 22 Vk genes in 0.4 Mb (T. Kirschbaum et al.,
this Journal 1998. 28: 1458 - 1466) and the 5’ part with 63 Vk genes in six contigs of together 1.5
Mb (F. Röschenthaler et al., accompanying report). The 5’ and the central regions
have one large contig in common. A part of the central region is linked to the 3’
region resulting in a 1.1 Mb contig. The central part of the k locus contains 24 members of the Vk 4/5 gene family, while nine Vk 4/5 genes are located in the 5’ part. The Vk 33/34 genes and relics are
interspersed among the Vk
4/5 genes. The Vk 4/5 gene
containing contigs are flanked at the 3’ side by a contig of Vk 12/13 and Vk 23 genes, which is linked in one large contig to the Vk 8, Vk 19/28 and Vk 22 gene region, the Vk 21 genes and Jk Ck
. In the latter region also sequences related to an S-adenosyl methionine decarboxylase
gene were found.
Addendum: Restriction maps of the contigs in the central part of the k locus
In Fig. 2 of the printed report, an overview of the restriction maps of the contigs of this region comprising 1.2 Mb is shown. Only cleavage sites for some less frequently cutting restriction nucleases are included in the overview. In this file the constituent clones and the maps with sites also for some more frequently cutting nucleases are presented.
The map up to position 430 is documented only in the printed version of ref. (a). Misprints: p. 2059 underneath the legend of Fig. 2: ...only at the 5' side of the BssHII site....; p. 2062: the correct accession number of sad is AJ 132684.
Legend to the detailed restriction maps complementing the data of the printed version:
Vk genes are indicated as boxes with the leaders as vertical lines. Arrows underneath the genes designate transcriptional polarities which were assigned by combining the sequence and the map information; details are available from the authors on request. Cleavage sites of less frequently cutting nucleases are shown in the top line of each panel while those of more frequently cutting nucleases are noted underneath as small vertical bars; dotted lines indicate that the nucleases have not been mapped in the respective regions. Both isoschizomers of KpnI, Asp718I and Acc651, were used. Cosmid clones are shown as horizontal lines; for the designations M, B, C, D, E, F, V and W see Fig.1 and section 4.1 of the printed report. The orientation of the cosmid inserts is noted: SC, SalI, ClaI in pHC79; PC, PvuI, ClaI in SuperCos 1; a B at the respective side of the cosmid indicates that a BamHI site has been conserved or created in cloning (B-PC or PC-B). The scale is in kb; in contig Z1 zero is set at Jk Ck ; in Z2 -Z4 zero is set at the 5’ end of each contig.
(A) The Vk 4/5 gene region (Z2 – Z4). PCR fragments are indicated. The BACs 2E24, 20P21 and 83M14 were identified with the gene ga33 as hybridization probe. The YAC FEXE10 is described in the printed report.
(B) The region of interdigitated Vk 12/13 and Vk 23 genes and the region of theVk 8 - Vk19/28 - Vk 22 clan (Z1). Among the numerous cosmid clones the ones depicted as dashed lines refer to clones that have not been independently mapped, but have been assigned to the respective region on the basis of known nuclease cleavage patterns. In the cluster of SphI sites at position 890 the two dashed lines indicate alternative positions of one cleavage site. sad refers to a sequence similar to the ones of the gene for a S – adenosyl methionine decarboxylase (see 2.4 of the printed version). The PCR product bridging the Vk 8-26 and Vk 8-27 regions was formed with the help of primers derived from the termini of the cosmid clones W41 and B84 : GAGAAGGTCCCGTGATGTGC and CCGAGGAATACTGAATGGCTG. The Vk 19-29 / Vk 8-30 gap was bridged with the PCR primers GTGCTTTCAGTAAGAGATGTACC and TTGGAGATATAACTGAGCCTGC derived from the cosmid clones B85 and B100, respectively. Cosmids BC330N7 and 14 derived from BAC 330N4 are shown in the region of the Vk gene 22-33. The BACs 45A5, 357G22 and 440E18 were isolated with the help of a 450 bp XbaI - EcoRI fragment located near the 5’ end of cosmid B85; this is due to the crosshybridizations described in section 2.4 of the printed report.
For restriction maps click the following:
Z1
(Z1-4 to Z1-10); Z2 and Z3
[For the 3' part of Z4, which is described in ref.(b) see below in (e)]
(c) Röschenthaler, F., Kirschbaum, T., Heim, V., Kirschbaum, V., Schäble, K. F., Schwendinger, J., Zocher, I. and Zachau, H.G.
The 5’ part of the mouse immunoglobulin k locus. Eur. J. Immunol 1999, 29: 2065-2071.
ABSTRACT
The 5’ region of the mouse k locus comprises 63 Vk genes in six contigs of together 1.5 Mb, including one which links
the region to the central part of the locus. The region of the k locus described here contains Vk1, Vk2,
Vk9/10, Vk11, Vk12/13, Vk20, Vk24, Vk32, Vk33/34 and Vk38C genes as well as the VkRF gene and, towards the center of the locus, a number of Vk4/5 genes. Near the 5’ end of the
locus interspersed a-tubulin
gene - like sequences were found. At its 3’ side the region borders on the Vk4/5 contigs of the central region of
the locus which is described in the accompanying report (T. Kirschbaum et al., 1999). In a
concluding section the main features of the structure of the mouse k locus are summarized: nine contigs of
together 3.1 Mb were constructed. Assuming about 250 kb of still uncloned DNA in the gaps
between the contigs the size of the k locus is estimated to be close to 3.4 Mb, at least 90% of which
has been cloned. 140 Vk
genes and 18 relics were sequenced, the most 5’ situated gene being a functional Vk24 gene. There is evidence for the
existence of two to five additional Vk genes in the locus. 56 of the Vk genes are in the same 5’, 3’ polarity as JkCk, 76 in opposite polarity and for eight the polarity is still
undetermined.
For restriction maps of the 5'-part of the locus, see below in (e).
(d) Thiebe, R., Schäble, K. F., Bensch, A., Brensing-Küppers, J., Heim, V., Kirschbaum, T., Lautner-Rieske, A., Mitlöhner, H., Ohnrich, M., Pourrajabi, S., Röschenthaler, F., Schwendinger, J., Wichelhaus, D. P., Zocher, I., and Zachau, H. G.
The variable genes and gene families of the mouse immunoglobulin k locus. Eur. J. Immunol 1999, 29: 2072-2081.
ABSTRACT
118 mouse Vk genes are described which, together with the 22 Vk genes reported previously (T.
Kirschbaum et al., this Journal 1998. 28: 1458 - 1466) amount to 140 genes that had
been cloned and sequenced in our laboratory. For 73 of them cDNAs are known, i.e.
they have to be considered functional genes, although ten genes of this group have
1bp-deviations from the canonical promoter, splice site or heptanucleotide recombination
signal sequences. 20 Vk genes have been defined as only potentially functional since they
do not contain any defect, but no cDNAs have been found (yet) for them. 47 of the 140 Vk genes are pseudogenes. In addition 18
relics, i. e. highly diverged and / or truncated genes, and five orphon Vk genes have been sequenced. There are
indications for two to five Vk genes or pseudogenes to exist in the k locus which we have not yet been able to clone. This is still very
close to the 140 Vk genes
of the mouse k locus
previously postulated (T. Kirschbaum et al., this Journal 1996, 26:1613 - 1620).
The 140 Vk genes and
pseudogenes were assigned to 18 gene families, four of them being one-member families.
This differs from previous enumerations of the families only by the combination of the Vk 9 and Vk 10 families and by the addition of the Vk dv gene as a new separate family. Sequence identity usually was
80% or above within the gene families and 55 – 80% between genes of different
families. Many of the mouse Vk gene families show significant homologies to the human ones
indicating that Vk gene
diversification predated in evolution the divergence of the primate and rodent clades.
Note added in proof: the sequencing of an additional Vk9/10 gene, called bv9, is described.
Appendix to the report by R. Thiebe et al.: Karlheinz F. Schäble, Rainer Thiebe, Alexander Bensch, Jutta Brensing-Küppers, Verena Heim, Thomas Kirschbaum, Rosemarie Lamm, Marion Ohnrich, Soheil Pourrajabi, Franz Röschenthaler, Jürgen Schwendinger, Daniel Wichelhaus, Ines Zocher and Hans G. Zachau
Characteristics of the immunoglobulin Vk genes, pseudogenes, relics and orphons in the mouse genome. Eur. J. Immunol. 1999, 29: 2082-2086.
(e) Röschenthaler, F., Hameister, H. and Zachau, H. G. (2000)
The 5' part of the mouse immunoglobulin k locus as a continuously cloned structure. Eur.J. Immunol. 2000, 30: 3349-3354.
ABSTRACT
Five contigs of the 5’ part of the immunoglobulin k locus (F. Röschenthaler et al., 1999) have been linked by cosmid clones prepared from bacterial artificial chromosomes (BACs) and by PCR. One of the previously defined contigs which contains three pseudogenes (Z7) was shown by fluorescence in situ hybridization to be located near the k locus on chromosome 6, but not within the locus. Two additional Vk genes were identified, a potentially functional Vk 24 gene and a pseudogene of the Vk 9/10 family. This brings the number of localized and sequenced Vk genes in the locus to 140. The 5’ part of the k locus is now one contig of 1.88 Mb; it comprises 82 Vk genes. Other contigs of the locus are 65kb, 105kb and 1.04 Mb in size and contain 2, 5 and 51 Vk genes, respectively. The contigs are separated by gaps of 10-40 kb each.
For restriction maps click:
Z04-01 to Z04-05
Z04-06 to Z04-10
Z04-11 to Z04-15
Z04-16 to Z04-20Legend to the detailed restriction maps complementing the data of the printed version
Earlier experimental data on the present contig Z4 are reported in ref. (b) and (c).
The designations and abbreviations are as in the above legend of ref. (b).
Most BACs are shown only in Fig. 1 of the printed version. In the map of the Internet file only those BACs, which are important for contig linking are included; cosmid clones prepared from the BACs carry the first number and the letter of the BAC designation plus our running number of the screening experiment, e. g. BC466G36 or BC466G40.
PCR: the gap near Vk hg24 (Z4-8) was bridged using primers 5'-TAG GTC ACA AAT CAG GCC TCA ACA -3' on cosmid T1 and 5'-AGT TAC ACT GTA GTT ATC TTC AGG-3' on cosmid H15 with BAC 506K14 as template.
The gap on Z4-14 in the Vk ce9/hi24r region was spanned by LT-PCR with primers derived from the two genes and BAC 341F8 as template.
The gap on Z4-21 was closed by LT-PCR with primers derived from the M46 and V240 termini and YAC F1122 as template; a 2.8 kb PCR fragment was obtained; details in ref. (c).
The unique probe mentioned in section 2.4 of ref. (c) is a 0.8 kb EcoRI-HindIII fragment prepared from cosmid A92 (Z4-16) near its PB end.
The V
k genes, relics and orphons described in the above five publications (ref. a-e) are compiled in Tables 1, 2, and 3, respectively. The Tables are updated versions of the ones in the Appendix by Schäble et al. to ref. (d) and include the Vk genes reported in refs. (b) and (e).
Table 1: The V
k gene segments of the mouse k locus| Sub- groups
|
Genea | Contigb | EcoRI c |
Charact- |
-- | Acc.no.e | Literature f | cDNA g |
| vk1 | bb1 | Z4-8 | 3.9 |
+ | -- | AJ231201 | M28131; Vk 1A [7] | S54757 |
| -- | bl1 | Z4-5 | 5.3 |
+ | [2] | AJ231203 | D00082 (4); K 18.1 [8] | -- |
| -- | cq1 | Z4-8 | 6.9 |
- ex | [3] | AJ231204 | -- | -- |
| -- | cr1 | Z4-7 | 4.2 |
+ | [3] | AJ231205 | D00081 (1); K1A5 [8] | -- |
| -- | cs1 | Z4-14 | 2.4 |
+ | [4] | AJ231206 | -- | M64152 |
| -- | cv1 | Z4-11 | 12.6 |
+/- pr | [3] | AJ231207 | -- | U29595 |
| -- | cz1 | Z4-7 | 6.2 |
- pr, ex | -- | AJ231208 | -- | -- |
| vk2 | 2-35 | Z1-6 | 5.2 |
- rss | [1] | AJ231200 | -- | -- |
| -- | bd2 | Z4-1 | 3.2 |
+ | -- | AJ231196 | Z72384; Vk2 (70/3) [34] | M25996 |
| -- | bh2 | Z4-3 | 5.3 |
- rss | -- | AJ231197 | -- | -- |
| -- | bi2 | Z4-3 | 9.0 |
+ | -- | AJ231198 | -- | M34622 (3) |
| -- | bj2 | Z4-2 | 7.8 |
+ | -- | AJ231199 | Z72382; Vk2 (70/1) [34] | Z17401 |
| vk4/5 | 4-50 | Z1-10 | 4.4 |
+ | -- | AJ235938 | M10115 (1); k-(2154) [11];R13[12] | -- |
| -- | 4-51 | Z1-10 | 10.2 |
+ | [5] | AJ235939 | V01565 ; V-L8 [13]; L8 [37] | -- |
| -- | aa4 | Z4-20 | 8.0 |
+ | [5] | AJ231209 | H4 [37] | X59197 |
| -- | ab4 | Z4-20 | 8.0 |
- rss | [6] | AJ231210 | -- | -- |
| -- | ac4 | Z4-20 | 13.0 |
+/- rss | [6] | AJ231211 | 38con [37] | M20464 (3) |
| -- | ad4 | Z4-16 | 6.8 |
+ | [4] | AJ231212 | H1 [37] | -- |
| -- | ae4 | Z4-16 | 7.8 |
+ | [4] | AJ231214 | M25999 (1);4.68 [10];81con(1)[13] | -- |
| -- | af4 | Z4-16 | 8.0 |
+ | -- | AJ231213 | 84con (1) [38] | X65009 (5) |
| -- | ag4 | Z4-16 | 4.4 |
+ | -- | AJ231215 | R11 [37] | -- |
| -- | ah4 | Z4-18 | 7.2 |
+ | -- | AJ231216 | 72con [38] | -- |
| -- | ai4 | Z4-18 | 7.2 |
+ | -- | AJ231217 | 128con [38] | Z22050 |
| -- | aj4 | Z4-17 | 7.0 |
+/- ex | -- | AJ235940 | H8 [37] | U54534 (3) h |
| -- | al4 | Z4-18 | 11.0 |
+ | -- | AJ231218 | 18con [38] | -- |
| -- | am4 | Z4-18 | 6.9 |
+ | -- | AJ231219 | K01641 (1); 70Z/3 [12]; 67con [38] | M64156 |
| -- | an4 | Z4-16 | 3.7 |
+/- rss | -- | AJ231224 | R2 [37] | X14098 (1) |
| -- | ao4 | Z2 | 8.5 |
- ex, sp | [6] | AJ231220 | 118con [38] | -- |
| -- | ap4 | Z2 | 4.2 |
+ | -- | AJ231221 | 76con [38] | AF021872 |
| -- | aq4 | Z4-19 | 7.6 |
+ | [5] | AJ231222 | H13 [37] | S61341 |
| -- | ar4 | Z2 | 8.6 |
+ | [5] | AJ231223 | -- | -- |
| -- | at4 | Z2 | 8.7 |
+ | [5] | AJ231225 | nq2.6.1 [37] | M19906 (4) |
| -- | ay4 | Z4-13 | 5.4 |
+ | [4] | AJ231226 | -- | U73592 (4) |
| -- | ka4 | Z4-17 | 2.8 |
- ex | [5] | AJ231227 | -- | -- |
| -- | kb4 | Z4-15 | 7.4 |
+ | [5] | AJ231228 | X05555; X24 [14]; H6 [13] | -- |
| -- | kf4 | Z4-13 | 1.3 |
+/- rss | [5] | AJ231229 | -- | X14099 |
| -- | kg4 | Z4-15 | 8.5 |
- pr, ex | [4] | AJ231230 | -- | -- |
| -- | kh4 | Z2 | 4.0 |
+ | [5] | AJ231231 | M25998; 4.58 [10] | U60468 |
| -- | ki4 | Z4-19 | 1.9 |
- pr, ex, rss | [3] | AJ231232 | -- | -- |
| -- | kj4 | Z3 | 6.9 |
+ | [3] | AJ231233 | K00884; S107B [15]; R1 [37] | -- |
| -- | kk4 | Z3 | 6.5 |
+ | [3] | AJ231234 | S71118; H3 [16]; H3 [37] | M34586 |
| -- | kl4 | Z3 | 1.8 |
- | [3] | AJ235941 | -- | -- |
| -- | km4 | Z4-19 | 8.7 |
+ | [3] | AJ235942 | H9 (1) [37] | -- |
| -- | kn4 | Z4-18 | 8.7 |
+ | [3] | AJ235943 | R9 [37] | -- |
| -- | ko4 | Z1/Z2 | -- | + | -- | AJ239198 | 148con (4) [38] | -- |
| vk8 | 8-16 | Z1-3 | 4.2 |
+ | [1] | Y15977 | -- | M62929 |
| -- | 8-18 | Z1-3 | 4.0 |
- rss | -- | Y15979 | -- | -- |
| -- | 8-19 | Z1-3 | 9.0 |
+ | [4] | Y15980 | -- | M34743 |
| -- | 8-21 | Z1-3 | 15.5 |
+ | [2] | Y15982 | -- | U62050 |
| -- | 8-22 | Z1-3 | 4.0 |
- ex, rss, pr | -- | Y15983 | -- | -- |
| -- | 8-24 | Z1-4 | 4.0 |
+ | [1] | AJ235944 | -- | Z22037 |
| -- | 8-26 | Z1-4 | 4.4 |
- rss | [1] | AJ235945 | -- | -- |
| -- | 8-27 | Z1-5 | 3.7 |
+/- rss | -- | AJ235946 | -- | X59193 |
| -- | 8-28 | Z1-5 | 5.2 |
+ | [1] | AJ235947 | -- | M17488 |
| -- | 8-30 | Z1-5 | 15.5 |
+ | -- | AJ235948 | X77142 (5); H8 VL [17] | M34634 |
| -- | 8-31 | Z1-5 | 7.5 |
- pr, ex | -- | AJ235957 | -- | -- |
| -- | 8-34 | Z1-5 | 3.7 |
+ | -- | AJ235958 | -- | -- |
| vk9/10 | ba9 | Z4-8 | 3.7 |
+ | -- | AJ231235 | V01563; L6 [18] | M74713 |
| -- | bp9 | Z4-6 | 2.6 |
- ex | -- | AJ231236 | -- | -- |
| -- | bq9 | Z4-6 | 5.7 |
- ex | -- | AJ231237 | -- | -- |
| -- | br9 | Z4-4 | 7.8 |
- ex, rss | -- | AJ231238 | -- | -- |
| -- | bv9 | Z4-6 | 6.1 | + | -- | AJ242670 | V00804 (2); Vk 41 [33] | AF045508 (1) |
| -- | by9 | Z4-12 | 2.5 |
+/- rss | -- | AJ231239 | M18407 (1); 3386 5' V [19] | (44) |
| -- | bz9 | Z4-6 | 4.0 |
-ex | -- | AJ277844 | -- | -- |
| -- | cb9 | Z4-3 | 2.4 |
+ | -- | AJ231241 | -- | X96756 (3) |
| -- | ce9 | Z4-12 | 5.3 |
+/- rss | -- | AJ239197 | X05795; Vk IdCR [32] | M20281 |
| -- | cf9 | Z4-11 | 5.3 |
+ | [3] | AJ231243 | -- | U18586 |
| -- | cj9 | Z4-3 | 6.0 |
+ | -- | AJ231244 | K00880; MOPC173B [20] | M12191 |
| -- | cl9 | Z4-4 | 5.3 |
- pr, ex | -- | AJ231245 | -- | -- |
| -- | co9 | Z4-4 | 5.5 |
- ex, rss | -- | AJ231246 | -- | -- |
| -- | cp9 | Z4-13 | 3.9 |
+/- rss | [3] | AJ231247 | M54906; AJ2 [21] | M36261 |
| -- | cw9 | Z4-5 | 12.5 |
+ | -- | AJ231248 | AF003294; Igk-V9a [ 22] | X02177 (2) |
| -- | cx9 | Z4-2 | 10.5 |
- rss, ex, sp | -- | AJ231249 | Z72385; Vk9B(294A9) [34] | -- |
| -- | cy9 | Z4-5 | 3.0 |
+ | -- | AJ231250 | AF003295; Igk-V9b [22] | U20061 |
| vk11 | ia11 | Z4-9 | 5.7 |
- sp, ex | -- | AJ231252 | -- | -- |
| -- | ic11 | Z4-7 | 1.5 |
- rss, ex | -- | AJ231253 | -- | -- |
| -- | ie11 | Z4-6 | 0.9 |
-rss, ex | -- | AJ231255 | -- | -- |
| -- | if11 | Z4-4 | 5.4 |
+ | -- | AJ231256 | X54753; MSI-N17 [23] | U21579 |
| vk12/13 | 12-38 | Z1-7 | 10.5 |
+ | -- | AJ235951 | -- | U78500 |
| -- | 12-40 | Z1-8 | 3.7 |
- ex | -- | AJ235952 | -- | -- |
| -- | 12-41 | Z1-8 | 3.0 |
+ | -- | AJ235953 | M31554 (2); VkRFT2 [24] | L24555 |
| -- | 12-42 | Z1-8 | 9.8 |
- ex, rss | -- | AJ235954 | -- | -- |
| -- | 12-44 | Z1-8 | 3.0 |
+/- rss | -- | AJ235955 | -- | S61689 |
| -- | 12-46 | Z1-9 | 12.0 |
+ | -- | AJ235956 | -- | U29621 |
| -- | 12-47 | Z1-9 | 7.8 |
- ex, rss | -- | AJ235959 | -- | -- |
| -- | 12-49 | Z1-9 | 5.0 |
- ex, pr | -- | AJ235960 | -- | -- |
| -- | ci12 | Z4-11 | 2.7 |
+ | [3] | AJ235949 | -- | Y13991 (2) |
| -- | fg12 | Z4-19 | 4.5 |
- ex, pr | -- | AJ235933 | -- | -- |
| -- | fl12 | Z4-14 | 15.0 |
+ | -- | AJ235950 | -- | X59181 |
| -- | fr12 | Z4-19 | 5.5 |
- pr, sp, ex | [3] | AJ235934 | -- | -- |
| vk19/28 | 19-13 | Z1-2 | 14.0 |
+ | [2] | -- | J00569; identical to VTNP [43] | X75103 |
| -- | 19-14 | Z1-3 | 5.9 |
+ | [1] | Y15975 | -- | M26002 |
| -- | 19-15 | Z1-3 | 9.2 |
+ | [1] | Y15976 | -- | M19766 |
| -- | 19-17 | Z1-3 | 8.5 |
+ | -- | Y15978 | -- | M36250 |
| -- | 19-20 | Z1-3 | 3.7 |
+ | -- | Y15981 | -- | M31259 |
| -- | 19-23 | Z1-4 | 9.2 |
+ | -- | AJ235961 | -- | AF045512 |
| -- | 19-25 | Z1-4 | 5.9 |
+ | -- | AJ235962 | -- | AF004328(3) |
| -- | 19-29 | Z1-5 | 3.7 |
+ | [1] | AJ235967 | -- | -- |
| -- | 19-32 | Z1-6 | 2.6 |
+/- pr | [1] | AJ235968 | M14360 (3); V-Ser [25] | L30147 |
| vkdv | dv-36 | Z1-7 | 3.6 |
+ | [1] | AJ235966 | -- | -- |
| vk20 | bk20 | Z4-2 | 7.8 |
- sp, ex | -- | AJ231257 | Z72386; Vk20(294A9) [34] | -- |
| -- | bt20 | Z4-6 | 12.0 |
+ | -- | AJ231258 | -- | M55318 |
| -- | bw20 | Z4-4 | 10.5 |
+ | -- | AJ231259 | -- | X16678 |
| vk21 | 21-1 | Z1-1 | 3.4 |
+ | -- | -- | X16955; Vk 21G [42] | M31270 |
| -- | 21-2 | Z1-1 | 20.0 |
+ | -- | -- | X16954; Vk 21A [42] | M83099 |
| -- | 21-3 | Z1-1 | 20.0 |
+ | -- | Y15967 | K0216255; 18.5kb Vk [41] | X65094 |
| -- | 21-4 | Z1-1 | 8.5 |
+ | -- | Y15968 | 8.5kb Vk [41] | U29629 |
| -- | 21-5 | Z1-1 | 9.0 |
+ | -- | -- | K02161; 9.5kb Vk 21C[41] | M21522 |
| -- | 21-6 | Z1-1 | 6.0 |
- ex | -- | Y15969 | 6.0kb Vk [41] | -- |
| -- | 21-7 | Z1-1 | 1.5 |
+ | -- | Y15970 | K02158; 1.6kb Vk [41] | Z22098 |
| -- | 21-8 | Z1-2 | 4.3 |
- | -- | Y15971 | 4.0kb Vk [41] | -- |
| -- | 21-9 | Z1-2 | 4.3 |
+ | -- | Y15972 | 4.0kb Vk [41] | -- |
| -- | 21-10 | Z1-2 | 16.0 |
+ | -- | -- | K02160;16kb Vk , Vk 21B [41] | Z22079 |
| -- | 21-11 | Z1-2 | 5.8 |
- | -- | Y15973 | 6.0kb Vk [41] | -- |
| -- | 21-12 | Z1-2 | 1.4 |
+ | -- | Y15974 | K02159; 1.5kb Vk , Vk 21E [41] | U39824 |
| vk22 | 22-33 | Z1-6 | 4.5 |
+ | [2] | AJ235965 | AF044198; Vk 22G [40] | U29423 |
| vk23 | 23-37 | Z1-7 | 10.0 |
+ | -- | AJ235963 | -- | Z17400 |
| -- | 23-39 | Z1-8 | 11.0 |
+/- rss | -- | AJ235964 | M26003 (2); 23.32 [10] | S82437 |
| -- | 23-43 | Z1-8 | 1.6 |
+ | -- | AJ235973 | -- | M34528 |
| -- | 23-45 | Z1-9 | 1.6 |
+ | -- | AJ235974 | X13937; B1P8-7b-2 [26] | X86546 |
| -- | 23-48 | Z1-9 | 14.5 |
+ | -- | AJ235975 | V01564; L7 [18] | X70264 |
| vk24/25 | ha24 | Z4-7 | 9.0 |
- ex | -- | AJ231260 | -- | -- |
| -- | hc24 | Z4-9 | 1.8 |
- ex | -- | AJ132682 | -- | -- |
| -- | hd24 | Z4-9 | 2.2 |
- ex, pr | [3] | AJ231262 | -- | -- |
| -- | he24 | Z4-8 | 6.0 |
+ | -- | AJ132683 | K02418 (2); Vk 24B [31] | S74547 |
| -- | hf24 | Z4-1 | 10.0 |
+ | -- | AJ231263 | -- | AF045509 |
| -- | hg24 | Z4-8 | 13.5 |
+ | -- | AJ231264 | J00553; Vk 167 [27] | M19910 (2) |
| -- | hk24 | Z4-7 | 6.2 |
+ | -- | AJ277843 | -- | -- |
| vk32 | gk32 | Z4-11 | 12.0 |
- ex, rss | [3] | AJ231267 | -- | -- |
| -- | gl32 | Z4-10 | 3.1 |
- ex, rss | [3] | AJ231268 | -- | -- |
| -- | gr32 | Z4-10 | 3.8 |
+/- sp | -- | AJ231269 | U27011 (2); 1-10 [ 28] | M34636 |
| -- | gs32 | Z4-10 | 5.8 |
- pr , ex | -- | AJ231270 | -- | -- |
| vk33/34 | ga33 | Z4-17 | 3.4 |
- pr, ex, rss | -- | AJ231271 | -- | -- |
| -- | gm33 | Z4-15 | 3.4 |
+ | [4] | AJ231273 | M35156; Igk-V34c [29] | -- |
| -- | gn33 | Z4-15 | 4.0 |
+ | [5] | AJ231274 | M35154 (4); Igk-V34b [29] | U29631 (3) |
| -- | gp33 | Z4-15 | 2.7 |
- pr, ex, rss | [5] | AJ231275 | -- | -- |
| -- | gq33 | Z4-15 | 9.5 |
- pr, ex, rss | [5] | AJ231276 | -- | -- |
| -- | gu33 | Z4-20 | 6.7 |
- ex | [3] | AJ235969 | -- | -- |
| vk38c | gj38c | Z4-13 | 9.7 |
+ | [4] | AJ235935 | M64442; [30] | M57588 |
| vkRF | RF | Z4-10 | 3.1 |
+ | -- | AJ235936 | -- | X14621 |
| sadi | -- | Z1-5 | 2.1 | -- | [35] | AJ132684 | -- | -- |
| tub | -- | Z4-1 | 2.0 | -- | [36] | AJ235970 | -- | -- |
a The designations of the genes in contigs that have not been linked to Jk -Ck are in the order of their discovery (see section 2.1 in the main part of the report by Thiebe et al.). Abbreviated designations are used, e. g. aa4 for a Vk 4/5 gene. For comments on the gene ko4 see section 2.5. of Thiebe et al.
b The contig designations are the ones used in refs (a,b,e).
c The EcoRI fragment sizes are in kb.
d +, - and +/- designate, respectively, potentially functional genes, pseudogenes and genes with defects, for which, however, a cDNA can be found in the data base (for definitions see section 2.2 of ref (d) and ref (e)); the location of defects is noted as pr, promoter; sp, splice sites; ex, stop codons, small deletions or insertions in the exons; rss, recombination signal sequences. In the adjacent column, references to theses prepared in our laboratory are given [1 – 6], in which the respective sequencing strategies are described.
e Accession numbers of gene sequences described in refs. (a-e) and Schäble et al. at the EBI data library.
f Accession numbers of and references to the corresponding genomic gene sequences in the literature (including the designations of the genes) are noted. Rearranged genes or excised circular products are listed, if no gene sequences in the germline configuration were found in the data library. If there are several entries in the data library, one has been selected for this Table. There is no additional comment, if the compared genes were identical in their exon 2 sequences; in case differences were found, the number of bp is noted in parenthesis.
g Accession numbers of expression products, usually cDNAs, derived from the germline genes. Only such products are considered which differ from the respective germline sequences in 5 positions or less (see 2.2 Thiebe et al.). As in f) only one data base entry is selected and the number of sequence differences is noted in parenthesis. Ref. 44 at by9 refers to the expression at an extremely low level.
h The finding of a cDNA [39] for the gene aj4 which has a stop codon in exon 2 is discussed in 2.5 of Thiebe et al.
i The accession number in ref.(b)
is misprinted.
Table 2: Relics in the mouse
k locus| -- | Relic a | Contig b | Characteristic |
Acc.no. d |
| vk1 | bc1r | Z4-1 | 6.6 EcoRI |
AJ231202 |
| vk23 | fp23r | Z1-8 | 2.8 EcoRI |
AJ235976 |
| vk24/25 | hb24r | Z4-12 | 2.3 EcoRI |
AJ231261 |
| -- | hh24r | Z4-13 | -- | AJ231265 |
| -- | hi24r | Z4-12 | 1.65 EcoRI |
AJ231266 |
| vk32 | gt32r | Z4-10 | 4.8 EcoRI |
AJ231251 |
| vk33/34 | gb33r | Z4-16 | 2.6 EcoRI |
AJ132671 |
| -- | gc33r | Z4-20 | 6.8 EcoRI |
AJ132672 |
| -- | gd33r | Z4-18 | 2.6 EcoRI |
AJ132673 |
| -- | ge33r | Z4-16 | 1.25 EcoRI |
AJ132674 |
| -- | gf33r | Z4-14 | 4.5 EcoRI |
AJ231272 |
| -- | gg33r | Z2 | 13 EcoRI |
AJ132675 |
| -- | gh33r | Z4-20 | 2.5 EcoRI |
AJ132676 |
| -- | go33r | Z4-18 | 2.7 EcoRI |
AJ132677 |
| -- | gv33r | Z4-18 | 3.5 Hind III |
AJ132678 |
| -- | gx33r | Z2 | 4.0 EcoRI |
AJ132679 |
| -- | gy33r | Z2 | 2.5 EcoRI |
AJ132680 |
| -- | gz33r | Z2 | 2.5 EcoRI |
AJ132681 |
a The designation of the relics is
analogous to the one of the Vk genes and pseudogenes, except that an ‘r’ is
added.
b The contig designations are the ones
used in refs (a-e)].
c The sizes of the characteristic
fragments are in kb.
d Accession numbers at the EBI data
library.
Table 3: The V
k orphons in the mouse genome| -- | Orphon a | Contig b | EcoRI c | Acc.no. d | Literature e |
| vk1 | gw1 | O6 | 11.0 |
AJ235937 |
X58991; VkY 1.7 [9] |
| vk2 | be2 | O16 | 5.1 |
AJ235971 |
Z72381; Vk2 (68) [34] |
| -- | bn2 | O19 | 7.2 |
AJ235972 |
Z72383; Vk2 |
| vk9/10 | bg9 | O16 | 7.0 |
AJ235977 |
-- |
| -- | ca9 | O6 | 2.6 |
AJ231240 |
X58992 (1); VkY 9B.8 [9] |
| -- | cc9 | O6 | 4.5 |
AJ235977 |
-- |
| vk20 | bf20part1 | O16 | 5.1 |
AJ235930 |
-- |
| -- | bf20part2 | O16 | 6.5 |
AJ235929 |
-- |
| -- | bu20part1 | O19 | -- | AJ235931 |
-- |
| -- | bu20part2 | O19 | -- | AJ235932 |
-- |
a Designations of the orphons.
Parts 1 and 2 of the Vk 20 orphons are separated by a repetitive element (see Schäble et
al.).
b Contigs on chromosomes 6, 16 and 19.
c EcoRI fragment sizes in kb.
d Accession numbers at the EBI Data
Library.
e Accession number of and references
to related genes in the literature.
References to Tables 1 to 3
1 Pourrajabi, S., Immunglobulin-Vk -Gene der Maus. Beiträge zur Struktur der Ck -proximalen Region des Locus. Dr. rer. biol. hum. - thesis, Medizinische Fakultät der Universität München, 1998.
2 Schwendinger, J., Beiträge zur Strukturaufklärung des murinen Immunglobulin - k - Locus mit Hilfe der Gensequenzierung und Pulsfeld-Gelelektrophorese. Dr. rer. biol. hum. - thesis, Medizinische Fakultät der Universität München, 1999.
3 Ohnrich, M., Beiträge zur Aufklärung der Struktur der Vk - Gene und des Immunglobulin - k - Locus der Maus. Dr. rer. biol. hum. - thesis, Medizinische Fakultät der Universität München, 1999.
4 Heim, V., Charakterisierung und Verknüpfung von klonierten Bereichen des Immunglobulin - k -Locus der Maus. Dr. rer. biol. hum. - thesis, Medizinische Fakultät der Universität München, 1999.
5 Bensch, A., Immunglobulingene vom k -Typ. Beiträge zur Struktur der zentralen Region des Locus der Maus. Dr. rer. biol. hum. - thesis, Medizinische Fakultät der Universität München, 1998.
6 Wichelhaus, D.P., Sequenzanalyse dreier variabler Vk -Gensegmente aus der Sequenzfamilie 4/5 der murinen Immunglobulingene. Doctoral thesis, Medizinische Fakultät der Universität München, 1995.
7 Ng, K.H., Lavigueur, A., Ricard, L., Bouvrette, M., MacLean, S., Cloutier, D. and Gibson, D.M., Characterization of allelic Vk-1 region genes in inbred strains of mice. J. Immunol. 1989. 143: 638-648.
8 Corbet, S., Milili, M., Fougerau, M. and Schiff, C., Two V kappa germ-line genes related to the GAT idiotypic network (Ab1 and Ab3/Ab1’) account for the major subfamilies of the mouse V kappa –1 variability subgroup. J. Immunol. 1987. 138: 932-939.
9 Lawler, A. M., Umar, A. and Gearhart, P., Linkage of two pseudogenes from the Vk 1 and Vk 9 murine immunoglobulin families. Mol, Immunol. 1992. 29: 295 – 301.
10 Lawler, A.M., Kearney, J.F., Kuehl, M. and Gearhart, P.J., Early rearrangements of genes encoding murine immunoglobulin kappa genes, unlike heavy genes, use variable gene segments dispersed throughout the locus. Proc. Natl. Acad. Sci. USA. 1989. 86: 6744-6747.
11 Kelley, D.E., Wiedemann, L.M., Pittet, A.C., Strauss, S., Nelson, K.J., Davis, J., Van Ness, B. and Perry, R.P., Nonproductive kappa immunoglobulin genes: recombinational abnormalities and other lesions affecting transcription, RNA processing, turnover, and translation. Mol. Cell. Biol. 1985. 5:1660-1675.
12 Parslow, T.G., Blair, D.L., Murphy, W.J. and Granner, D. K., Structure of the 5’ ends of immunoglobulin genes: A novel conserved sequence. Proc. Natl. Acad. Sci. USA. 1984. 81: 2650-2654.
13 Hoechtl, J., Mueller, C.R. and Zachau, H.G., Recombined flanks of the variable and joining segments of immunoglobulin genes. Proc. Natl. Acad. Sci. USA. 1982. 79: 1383-1387.
14 Heller, M., Owens, J.D., Mushinski, J.F. and Rudikoff, S., Amino acids at the site of Vk-Jk recombination not encoded by germline sequences. J. Exp. Med. 1987. 166: 637-646.
15 Kwan, S.P., Max, E.E., Seidman, J.G., Leder, P. and Scharff, M.D., Two kappa immunoglobulin genes are expressed in the myeloma S107. Cell 1981. 26:57-66.
16 Rada, C., Gonzalez-Fernandez, A., Jarvis, J.M. and Milstein, C., The 5’ boundary of somatic hypermutation in a V kappa gene is in the leader intron. Eur. J. Immunol. 1994. 24: 1453-1457.
17 Jin, B.R., Ryu, C.J., Park, S.S., Namgung, U., Hong, H.J. and Han, M.H., Cloning, expression and characterization of a murine-human chimeric antibody with specifity for pre-S2 surface antigen of hepatitis B virus. Mol. Immunol. 1993. 30: 1647-1654.
18 Pech, M., Höchtl, J., Schnell, H. and Zachau, H.G., Differences between germ-line and rearranged immunoglobulin Vk coding sequences suggest a localized mutation mechanism. Nature 1981. 291: 668 –670.
19 Shapiro, M. A. and Weigert, M., How immunoglobulin Vk genes rearrange. J. Immunol. 1987. 139: 3834 – 3839.
20 Max, E.E., Seidman, J.G., Miller, H. and Leder, P., Variation in the crossover point of kappa-immunoglobulin gene V-J recombination: evidence from a cryptic gene. Cell. 1980. 21: 793-799.
21 Kim, S.O., Sanz, I., Williams, C., Capra, J.D. and Gottlieb, P.D., Polymorphism in V kappa 10 genes encoding L chains of antibodies bearing the Ars-A and A48 cross-reactive idiotypes. Immunogenetics. 1991. 34:231-241.
22 Ulrich, H.D., Moore, F.L. and Schultz, P.G., Germline diversity within the mouse Ig?-V9 gene family. Immunogenetics. 1998. 47: 91-95.
23 Hirama, T, Takeshita, S., Yoshida, Y. and Yamagishi, H., Structure of extrachromosomal circular DNAs generated by immunoglobulin light chain gene rearrangements. Immunology Letters. 1991. 27: 19 – 24.
24 Heinrich, G., Gram, H., Kocher, H.P., Schreier, M.H., Ryffel, B., Akbar, A., Amlot, P.L. and Janossy, G., Characterization of a human T cell-specific chimeric antibody (CD7) with human constant and mouse variable regions. J. Immunol. 1989. 143: 3589-3597.
25 Boyd, R.T., Goldrick, M.M. and Gottlieb, P.D., Structural differences in a single gene encoding the Vk-Ser group of light chains explain the existence of two mouse light-chain genetic markers. Proc. Natl. Acad. Sci. USA. 1986. 83: 9134-9138.
26 Mueller, B. and Reth, M., Ordered activation of the Ig (lambda) locus in Abelson B cell lines. J. Exp. Med. 1988. 168: 2131-2137.
27 Gearhart, P.J. and Bogenhagen, D.F., Clusters of point mutation are found exclusively around rearranged antibody variable genes. Proc. Natl. Acad. Sci. USA. 1983. 80: 3439-3443.
28 Bloom, D. D., Davignon, J. – L., Retter, M. W., Shlomchik, M. J., Pisetsky, D. S., Cohen, P. L., Eisenberg, R. A. and Clarke, S. H., V region gene analysis of anti – Sm hybridomas from MRL / Mp – lpr / lpr mice. J. Immunol. 1993. 150: 1591 – 1610.
29 Valiante, N.M. and Caton, A.J. A new Igk-V gene family in the mouse. Immunogenetics. 1990. 32: 345-350.
30 Stepchenko, A.G., Adzhalow, V.A., Deev, S.M., Polyanovskii, O.L., Regulatory sequences in the k -chain gene expressed in the hybridoma PTF.02. Genetika 1986. 22: 2228-2235; translated by Plenum Publishing Corporation, 1987, 1093 –1099.
31 Joho, R., Gershenfeld, H. and Weissman, I. L., Evolution of a multigene family of Vk germline genes. Embo. J. 1984. 3: 185 - 191.
32 Wysocki, L. J., Bridley, T., Huang, S., Grandea III, A. G. and Gefter, M. L., Single germline VH and Vk genes encode predominating antibody variable regions elicited in strain A mice by immunization with p-azophenylarsonate. J. Exp. Med. 1987. 166: 1 – 1
33 Seidman, J. G., Max, E. E. and Leder, P., A k -immunoglobulin gene is formed by site-specific recombination without further somatic mutation. Nature 1979. 280: 370–375.
34 Schupp, I.W., Schlake, T., Kirschbaum, T., Zachau, H.G. and Boehm, T., A yeast artificial chromosome contig spanning the mouse immunoglobulin kappa light chain locus. Immunogenetics 1997. 45: 180-187.
35 Kirschbaum, T., Röschenthaler, F., Bensch, A., Hölscher, B., Lautner-Rieske, A., Ohnrich, M., Pourrajabi, S., Schwendinger, J., Zocher, I. and Zachau. H. G., The central part of the mouse immunoglobulin k locus. Eur. J. Immunol. 1999, 29: 2057-2064. = ref (b).
36 Röschenthaler, F., Kirschbaum, T., Heim, V., Kirschbaum, V., Schäble, K.F., Schwendinger , J., Zocher, I. and Zachau, H. G., The 5’ part of the mouse immunoglobulin k locus. Eur. J. Immunol. 1999, 29: 2065-2071. =ref.(c).
37 Even, J., Griffiths, G.M., Berek, C. and Milstein, C., Light chain germ-line genes and the immune response to 2-phenyloxazolone. EMBO J. 1985. 4: 3439-3445.
38 Milstein, C., Even, J., Jarvis, J.M., Gonzalez-Fernandez, A. and Gherardi, E., Non-random features of the repertoire expressed by the members of one Vk gene family and of the V-J recombination. Eur. J. Immunol. 1992. 22: 1627-1634.
39 Seidl, K. J., MacKenzie, J. D., Wang, D., Kantor, A. B., Kabat, E., Herzenberg, L. A. and Herzenberg, L. A., Frequent occurrence of identical heavy and light chain Ig rearrangements. Internat. Immunol. 1997. 9: 689 – 702.
40 Whitcomb, E. A. and Brodeur, P. H. , Rearrangement and selection in the developing Vk repertoire of the mouse: an analysis of the usage of two Vk gene segments. J. Immunol. 1998. 160: 4904–4913.
41 Heinrich, G., Traunecker, A. and Tonegawa, S., Somatic mutations creates diversity in the major group of mouse immunoglobulin k light chains. J. Exp. Med. 1984. 159: 417 - 435.
42 Alanen, A. and Weiss, S., Sequence and linkage of the Vk 21 A and G germline gene segments in the mouse. Eur. J. Immunol. 1989. 19: 1961 - 1963.
43 Hawley, R. G., Shulman, M. J., Murialdo, H., Gibson, G. M. and Hozumi, N., Mutant immunoglobulin genes have repetitive DNA elements inserted into their intervening sequences. Proc. Natl. Acad. Sci. USA 1982. 79: 7425 - 7429.
44 Fitzsimmons, S.P., Clark, K.J., Mostowski, H.S. and Shapiro, M.A., Under-utilization of the Vk10C gene in the B cell repertoire is due to the loss of productive VJ rearrangements during B cell development. J Immunology 2000, 165: 852-859.
Last update: July 2000/October 2001
