Yeast Transcription Factors

YEAST TRANSCRIPTION FACTORS, DNA-BINDING PROTEINS AND RELATED COMPONENTS
Gene	Alternate Gene Name	Systematic Name	Type of Factor Red: Transcription factors (activators/repressors) Blue: Basal transcription factors Black: Related to transcription factors	Functions Effetcs	DNA-Binding	Interactions Complexes	Features	Gene
ABF1	BAF1 OBF1 REB2	YKL112W	ARS-binding factor I	Activation of DNA-replication and transcriptional regulation of various genes	RTCRYNNNNNACG	*Req. for RNA polymerase I enhancer function	CHC2-type zinc finger Polyasparagine stretches * 202 C-term acid domain req. for activation of ARS function Two regions within the essential domain (aa 679-731) able to perform all essential functions in the absence of the other Transcription of ABF1 seems to be autoregulated *Bends DNA at its binding site by about 120 deg	ABF1
ABF2	CDRP1 HIM1	YMR072W	Abundant mitochondrial DNA-binding protein	.	.	.	2 HMG-box domains * Homologous to HMG1 and HMG2 Can introduce DNA bending at particular sites	ABF2
ACE1	CUP2	YGL166W	Metallothionein gene activator 1	Req. for activation of CUP1 transcription at elevated copper concentrations Binding reduced Cu (I) ions permits Cup2p to bind to promoters of metallothionein genes	Binds to one site in SOD1 promoter and 4 siites in CUP1 promoter	.	Contains a copper-fist domain Forms a tetracopper-thiolate cluster in the copper-regulatory domain upon induction N-term is cysteine-rich and basic, while C-term is acidic Sequence similarity to Mac1p	ACE1
ACE2	.	YLR131C	Metallothionein gene activator 2	Involved in regulation of basal and induced activity of histidine and adenine biosynthesis genes	.	.	.	ACE2
ADA1	SUP110 P1001 GAN1	YPL254W	Adenosine deaminase	Required for the overall structural integrity of the SAGA complex	.	SAGA transcriptional activator-histone acetyltransferase complex	.	ADA1
ADA2	SWI8	YDR448W	Transcription factor	.	.	SAGA transcriptional activator-histone acetyltransferase complex ADA, histone acetyltransferase A complex	.	ADA2
ADA3	NGG1 SWI7	YDR176W	Transcription factor	Genetic interaction with SWI1	.	SAGA transcriptional activator-histone acetyltransferase complex ADA, histone acetyltransferase A complex	.	ADA3
ADR1	.	YDR216W	Alcohol dehydrogenase repressible protein 1 Transcription factor	Transcriptional activator of ADH2 when not phosphorylated	GGAGA (22 bp inverted dyad symmetry)	.	Two C2H2-type zinc finger domains, each finger folding independently into a beta-beta-alpha structure typical of C2H2 zinc finger domains Single acidic activation domain (pos. 420-462) fused to the DNA-binding domain is sufficient for all known Adr1p functions	ADR1
AFT1	RCS1	YGL071W	Regulatory protein involved in iron uptake	Phosphorylated after shift from glucose to other carbon sources Phosphorylation during nutritional shift Snf1p-independent *Phosphorylation occurs normally during the diauxic shift; not induced by iron starvation	PyPuCACCCPu	.	N-term is basic Interacts with iron through a histidine-rich region, which might inhibit its ability to activate transcription *C-term glutamine-rich, may be req. for transactivation functions, essential for expression of the iron transport system	AFT1
ANC1	TFG3	YPL129W	TFIIF subunit (transcription initiation factor), 30 kD	.	.	TFIIF subcomplex	.	ANC1
ARGR1	ARG80	YMR042W	Arginine Regulatory Protein I	.	.	Component of ARGR transcription regulatory complex (ArgR1p, ArgR2p, ArgR3p, Mcm1p)	Amino acids 155-177 essential for function N-term region (aa 39-53) contains a stretch of acidic amino acids *C-term 23 amino acids req. for arginine regulation	ARGR1
ARGR2	ARG81	YML099C	Arginine Regulatory Protein II	.	CACCTCTA	Component of ARGR transcription regulatory complex (ArgR1p, ArgR2p, ArgR3p, Mcm1p)	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region	ARGR2
ARGR3	IMK ARGRIII ARG82 IPK2 GSL3	YDR173C	Inositol polyphosphate multikinase	.	.	Component of ARGR transcription regulatory complex (ArgR1p, ArgR2p, ArgR3p, Mcm1p)	.	ARGR3
ARP7	RSC11 SWP61	YPR034W	Transcription factor	Acts to assist gene-specific activators through chromatin remodeling	.	Component of SWI/SNF activator and RSC chromatin remodeling complexes	ATP-binding domain	ARP7
ARP9	RSC12 SWP59	YMR033W	Transcription factor	Acts to assist gene-specific activators through chromatin remodeling	.	Component of SWI/SNF activator and RSC chromatin remodeling complexes	ATP-binding domain	ARP9
ARR1	YAP8 (ACR1)	YPR199C	bZIP-type transcription factor	Mediates arsenic resistance	TTACTAA	.	Belongs to the eight-member family of basic leucine zipper (bZIP) proteins: Yap1p, Cad1p, Yap3p, Cin5p, Yap5p, Yap6p, Yap7p, Arr1p bZip motif is located in N-term region	ARR1
ASF1	.	YJL115W	Anti-silencing factor 1	Causes derepression of silent loci when overexpressed	.	Component of replication-coupling assembly (RCAF) complex	.	ASF1
ASF2	.	YDL197C	Anti-silencing factor 2	Causes depression of silent loci when overexpressed	.	.	.	ASF2
ASH1	.	YKL185W	GATA-type transcription factor	Negative regulator of HO expression Essential for pseudohyphal growth	.	Interaction with Swi5p is req. for HO expression	Zinc finger motif related to GATA transcriptional regulators mRNA abundance fluctuates during the cell cycle but peaks in early G1 phase	ASH1
BAS1	CAT8 (DIL1)	YMR280C	General transcription factor	Mediates regulation of basal and induced activity of histidine and adenine biosynthesis genes Req. for derepression of gluconeogenic enzymes	TGACTC	.	Zn-finger protein with myb-like DNA-binding motif Major activation domain located between amino acids 400 and 630	BAS1
BAS2	PHO2 GRF10	.	See GRF10	.	.	.	.	BAS2
BEM1	SRO1	YBR200W	Protein required for cell polarization and bud formation	* May coordinate MAP kinase cascade activation with cell cycle control *Might be a component of a pathway for Ste20p-dependent regulation of cytokinesis	.	Associates with Far1p and Ste5p Associates with Ste11p, Ste7p, and Fus3p, probably indirectly through their association with Ste5p *Interacts with C-term 75 amino acid region of Cdc24p	*Two SH3 domains	BEM1
BUR6	NCB1	YER159C	NC2 (Dr1/Drap1) repressor of class II transcription, alpha subunit	.	.	Binds to TATA-binding protein (TBP1/Spt15p) as a heterodimer with Ncb2p	Negative Cofactor B1	BUR6
CAD1	YAP2	YDR423C	Transcriptional activator of the bZIP-family	Mediates multidrug resistance Transcriptional regulator of Ycf1p Not involved in response to superoxide Transcriptional activity inhibited by protein kinase A * Mediates cadmium-induced transcription of AP-1 recognition element (ARE promoter) Can suppress yap1 cadmium sensitivity but not yap1 hydrogen peroxide sensitivity Does not regulate TRX2, SSA1, GSH1, TPS1, TPS2, or TPS3	TTACTAA	.	Belongs to the eight-member family of basic leucine zipper (bZIP) proteins: Yap1p, Cad1p, Yap3p, Cin5p, Yap5p, Yap6p, Yap7p, Arr1p Two short upstream ORFs regulate expression by destabilizing CAD1 mRNA via a UPF1-independent pathway	CAD1
CAF4	.	YKR036C	Ccr4p associating protein	.	.	.	WD (WD-40) repeats	CAF4
CAT8	(MSP8) DIL1	YMR280C	Zinc-finger type transcription factor	*Required for derepression of gluconeogenic enzymes Glucose induces dephosphorylation of Cat8p in a Glc7p-independent manner	.	Not a component of the complex of proteins that binds to the carbon source-responsive element (CSRE), but positively controls genes for proteins in the complex	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region Cat8p is probably activated by Snf1p/Snf4p protein kinase	CAT8
CBF1	CPF1 (CBP1) CEP1 CP1	YJR060W	Centromere Binding Factor	Req. for chromosome stability, optimal centromere activity and methionine prototrophy May be involved in regulating transcription of MET17, MET2, MET3, and SAM2, all of which contain upstream CDE1 sequences	AAWTWARTCACRTGATAWAWWT	*Binding to the sequence TCACGTG stabilizes the binding of the Met4p-Met28p-Met31p and Met4p-Met28p-Met32p complexes to the adjacent sequence AAACTGTG Met4p provides the transcriptional activation function to the Cbf1p-Met4p-Met28p complex	Basic-helix-loop-helix (bHLH) DNA-binding protein No typical transcription activation domain *Causes bending of DNA	CBF1
CBF5	LUC8	YLR175W	Centromere/microtubule binding protein	Putative ribosomal RNA pseudouridine synthase, associated with H/ACA class small nucleolar RNAs	.	.	.	CBF5
CCL1	.	YPR025C	TFIIH subunit (transcription initiation factor), cyclinC component	.	.	Component of C-terminal domain (CTD) kinase subcomplex TFIIK (Kin28p and Ccl1p) of TFIIH; required for transcription but missing from repairosome form of TFIIH	.	CCL1
CCR4	FUN27 NUT21	YAL021C	Positive and negative transcriptional regulator	.	.	CCR4 transcriptional regulatory complex; Ccr4p-NOT complex	.	CCR4
CDC13	EST4	YDL220C	Telomere-binding protein	Involved in protection of the telomere and required for access of telomerase to the chromosomal terminus	.	.	.	CDC13
CDC36	NOT2	YDL165W	Nuclear protein	Negatively affects basal transcription from many promoters	.	CCR4 transcriptional regulatory complex; Ccr4p-NOT complex	.	CDC36
CDC39	NOT1 ROS1	YCR093W	Nuclear protein that negatively affects basal transcription from many promoters	.	.	CCR4 transcriptional regulatory complex; Ccr4p-NOT complex	.	CDC39
CHA4	SIL2 SIL3	YLR098C	Transcriptional activator of CHA1	.	.	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain	CHA4
CHD1	.	YER164W	Chromodomain-Helicase-DNA-binding protein	.	.	.	.	CHD1
CIN5	YAP4	YOR028C	bZIP-type transcription factor	Involved in salt tolerance	TTACTAA	.	Belongs to the eight-member family of basic leucine zipper (bZIP) proteins: Yap1p, Cad1p, Yap3p, Cin5p, Yap5p, Yap6p, Yap7p, Arr1p	CIN5
CKA1	.	YIL035C	Casein kinase II, catalytic alpha chain	.	.	.	.	CKA1
CKA2	.	YOR061W	Casein kinase II alpha' chain	.	.	.	.	CKA2
CKB1	.	YGL019W	Casein kinase II, beta subunit	.	.	.	.	CKB1
CKB2	.	YOR039W	Casein kinase II beta' chain	.	.	.	.	CKB2
CMP2	CNA2	YML057W	Calcineurin catalytic (A) subunit	Protein serine/threonine phosphatase 2B(PP2B), member of the PPP family of protein phosphatases	.	.	.	CMP2
CNB1	YCN2 YCNB CRV1	YKL190W	Calcineurin regulatory (B) subunit	.	.	.	.	CNB1
CRZ1	TCN1	YNL027W	Calcineurin-dependent transcription factor	Calcineurin-responsive zinc finger protein Regulates gene expression downstream of calcineurin in response to multiple environmental signals	.	.	Two C2H2-type zinc-binding fingers.	CRZ1
CTK1	SNB32	YKL139W	C-terminal domain (CTD) kinase alpha subunit	Cyclin-dependent protein Phosphorylates C-terminal domain of RNA polymerase II large subunit	.	CTDK I, RNA polymerase C-terminal domain kinase complex; subunit Rpo21p	.	CTK1
CTK2	.	YJL006C	C-terminal domain (RNA polymerase II CTD) kinase beta subunit	Cyclin-related protein Interacts with the cyclin-dependent protein kinase Ctk1p	.	CTDK I, RNA polymerase C-terminal domain kinase complex	.	CTK2
CTK3	.	YML112W	C-terminal domain (RNA polymerase II CTD) kinase gamma subunit	Associates with Ctk1p and Ctk2p	.	CTDK I, RNA polymerase C-terminal domain kinase complex	.	CTK3
CUP2	ACE1	YGL166W	Copper-dependent transcription factor	Metallothionein (copper chelatin); identical to Cup1Bp Responsible for induction of CUP1A, CUP1B, CRS5, and SOD1	.	.	.	CUP2
CUP9	.	YPL177C	Homeodomain protein	Involved in copper homeostasis and in regulation of peptide import	Binds to a PTR2 promoter region from -448 to -897 as transcription repressor	.	Member of PBX family of homeobox proteins	CUP9
DAL80	UGA43	YKR034W	GATA-type zinc finger protein	Transcriptional repressor for allantoin and GABA catabolic genes Represses the urea catabolic pathway Negatively regulates itself, GZF3, UGA4, DAL7, DUR1,2 and UGA1	Two GATAAG sequences located within 21 bp of each other	Dal80p and Gzf3p can form a homodimer or a heterodimer; which one forms determines DNA binding specificity and affinity	*C-term domain, containing a leucine zipper motif, is responsible for homomeric interactions and essential for function	DAL80
DAL81	UGA35 DURL	YIR023W	Transcriptional activator for allantoin, GABA and urea catabolic genes	.	.	With Dal82p regulates allophanate-inducible genes	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region	DAL81
DAL82	.	YNL314W	Transcriptional activator for allantoin catabolic genes	.	.	.	DNA binding: first 85 residues Core domain (32 to 152) required for full transcriptional activation Potential coiled-coil domain (218 to 255) may play a negative role in transcriptional activation	DAL82
DST1	PPR2 YSII TFIIS STPalpha	YGL043W	Transcription elongation factor TFIIS Strand Transfer Protein	Transcription elongation factor S-II; DNA strand transfer protein catalyzing homologous DNA strand exchange	.	.	.	DST1
ECM22	.	YLR228C	Protein similar to transcription factors	.	.	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region	ECM22
(EGD1)	CST25	YPL037C	Nascent polypeptide-associated complex, beta subunit	.	.	.	.	(EGD1)
(EGD2)	.	YHR193C	Nascent polypeptide-associated complex, alpha subunit	.	.	.	.	(EGD2)
ELA1	.	YNL230C	Transcription elongation factor (Elongin A) for RNA Pol II	.	.	Ela1p-Elc1p	Contains an F-box domain	ELA1
ELC1	.	YPL046C	Transcription elongation factor (Elongin C) for RNA Pol II	.	.	Ela1p-Elc1p	.	ELC1
EZL1	.	YJL168C	Repressor of basal transcription of GAL4	.	.	.	.	EZL1
FHL1	.	YPR104C	Transcriptional activator of the forkhead/HNF3 family	.	.	.	Contains a forkhead-associated (FHA) domain	FHL1
FKH1	.	YIL131C	Homolog of Drosophila forkhead protein	Involved in transcriptional silencing, cell morphology and cell cycle	.	.	.	FKH1
FKH2	.	YNL068C	Homolog of Drosophila forkhead protein	Involved in transcriptional silencing, cell morphology and cell cycle	.	.	.	FKH2
FLO8	PHD10	YER108C	Transcriptional activator of FLO1	Req. for pseudohyphal formation in diploids Req. for invasive growth and flocculation in haploids	.	.	.	FLO8
FUN16	.	YAR003W	Protein of unknown function	.	.	.	WD (WD-40) repeat	FUN16
FZF1	(SUL1)	YGL254W	Transcription factor	Involved in sulfite tolerance along with Ssu1p, Grr1p, and Ssu3p Acts downstream of GRR1 and upstream of SSU1	.	.	.	FZF1
GAL11	RAR3 SDS4 SPT13	YOL051W	Component of RNA polymerase II holoenzyme and Kornberg's mediator complex	Has positive and negative effects on individual genes Req. for normal expression of GAL1, GAL7, and GAL10 Affects phosphorylation state of GAL4p Affects expression of MFAPLHA1, A1, A2, and PYK1, as well as Ty-mediated gene expression	.	Component of RNA polymerase II holoenzyme and Kornberg's mediator complex Transcription mediator complex contains Gal11p, Rgr1p, Sin4p, Srb4p, Med1p, Med2p, Pgd1p, Med4p, Med6p, Srb5p, Med7p, Med8p, Rox3p, Srb2p, Srb7p, Srb6p *Mediator complex consists of Gal11p, Sin4p, Rgr1p, Srb2p, Srb4p, Srb5p, Srb6p, Srb7p, Srb8p, Srb9p, Anc1p, Ssn8p, Ssn3p, and other proteins	64 amino acid domain of poly-glutamine-alanine 23-amino acid glutamine domain and several shorter polyglutamine domains predicted to form a helix-loop-helix structure *May stimulate promoter activity by enhancing an association of TFIIE (Tfa1p and Tfa2p) with preinitiation complex in the cell	GAL11
GAL3	SRV1	YDR009W	Inducer of galactose pathway	Regulatory protein required for rapid induction of galactose pathway	.	Binds Gal80p	.	GAL3
GAL4	.	YPL248C	Transcription factor in expression of galactose-induced genes	Gal4p can activate transcription of genes whose promoter is located up to 600 base pairs away from UAS-G binding sites	CGG-N11-CCG	GAL4-AH transcription factor binds chromatin after alteration of the nucleosome core by the SWI/SNF complex, and remains bound after detachment of the complex Binding occurs independent of galactose, i.e. an example of an activator that can occupy its recognition site without activating transcription. *In the absence of inducer, Gal80p binds to GAL4 and prevents interaction with other components of transcription machinery.	Zn[2]-Cys[6] cluster (residues 14-57) contact DNA (crystal structure) Two helix-turn-helix motifs in the substrate binding domain which pack around the zinc-cysteine cluster Transcriptional activating region: two little acidic regions at 148-196 and 768-881 (C-term) 74 N-term amino acid residues are sufficient to bind Gal4p to the 17-mer UAS-G Nuclear transport signal in 74 N-term region GAL4 binds as a dimer	GAL4
GAL80	.	YML051W	Negative regulator in expression of galactose-induced genes	.	.	1:1 inhibitory complex with Gal4p	.	GAL80
GAL83	SPM1	YER027C	Factor involved in glucose repression	.	.	Interacts with Snf1p and Snf4p	.	GAL83
GAT1	NIL1	YFL021W	GATA zinc finger transcription factor involved in nitrogen regulation	.	.	.	.	GAT1
GCN4	ARG9 AAS3	YEL009C	Protein for general control in response to amino acid or purine starvation Transcription factor of the bZip type	*Activates transcription of more than 30 genes involved in the biosynthesis of 11 amino acids in response to amino acid starvation or impaired activity of tRNA synthetases	ATGAC/GTCAT (AP-1 site) and ATGACTCAT (ATF/CREB site)	.	GCN4 binds as a dimer to adjacent half-sites Acidic activation domain in the middle region of primary structure has critical hydrophobic residues, especially Tyr and Trp Leucine zipper of GCN4 (at extreme C-term portion) contains a basic domain followed by a five-fold leucine repeat: SSDPAALKRARNTEAARRSRARKLQRMKQ- LEDKVEELLSKNYHLENEVARLKKLVGER GCN4 gene expression is translationally regulated by general control: positively by GCN2 and GCN3, negatively by GCD1	GCN4
GCN5	ADA4 SWI9	YGR252W	Histone acetyltransferase	.	.	Component of two nucleosomal histone acetyltransferase complexes: SAGA and ADA	.	GCN5
GCR1	(SIT3) LPF10	YPL075W	Glycolysis regulatory factor 1	.	TTTCAGCTTCCTCTAT and CTTCC motif	In the Gcr1p-Gcr2p complex, Gcr1p binds DNA while Gcr2p activates transcription	Helix-turn-helix motif in C-term region N-term 300 residues essential for transcription activation and in vivo function Causes DNA bending Protein expressed at low level, very low codon bias index Activator of glycolytic genes	GCR1
GCR2	.	YNL199C	Glycolysis regulatory factor 2	.	.	In the Gcr1p-Gcr2p complex, Gcr1p binds DNA while Gcr2p activates transcription	Similarity to Gcr1p	GCR2
GLN3	.	YER040W	GATA-type zinc finger transcription factor for positive nitrogen regulation	Required for transcription of DAL80, GAT1 Positive regulator of GLT1 (glutamate synthase) and GLN1 (glutamine synthase) Activates PUT1, PUT2 and other nitrogen metabolizing genes when a good nitrogen source is not available	.	.	.	GLN3
GLO3	.	.	.	.	.	.	.	.
GRF1	RAP1 GRC4 (TUF1)	YNL216W	See RAP1	.	.	.	.	GRF1
GRF10	BAS2 PHO2	YDL106C	General regulatory factor 10	Regulates basal and induced activity of purin pathway genes	GGTAAATTAAGTTAATTAATTG AAAWKAGTTAATTRAWT	.	Homeodomain protein	GRF10
GRF2	REB1 (RBP1); QBP	YBR049C	See REB1	.	.	.	.	GRF2
GTS1	LRS1	YGL181W	Putative transcription factor of the gcs1p/glo3p/sps18p family	.	.	.	Contains one Glo-type CXXCX16CXXC zinc finger in N-term Contains a polyglutamine domain in C-term region *11 gly-ser/thr dimer repeats in the C-term region	GTS1
GZF3	DEH1 NIL2	YJL110C	GATA-type zinc finger transcription factor	Involved in nitrogen repression of gat1p-dependent expression Possibly functions by preventing activation of transcription by Gat1p * Negatively regulates expression of some nitrogen catabolic genes (GAP1, DAL80 and UGA4) on repressive nitrogen sources (glutamine, ammonia)	Single GATAAC (for negative regulation unlike negative regulation by Dal80p, which requires two properly spaced GATAAC sites	*Predicted leucine zipper motif in the C-term region is likely responsible for homodimer formation	Zinc finger domain in N-term region possible leucine zipper in C-term region Lacks the transcriptional activation region found in positive GATA factors such as Gln3p and Gat1p	GZF3
HAC1	ERN4 IRE15	YFL031W	Transcriptional activator in the unfolded protein response pathway	Req. to protect cells from stress in the endoplasmic reticulum Involved in KAR2 induction via Ire1p	Activates gene expression by direct binding to unfolded protein response (UPRE) element	.	1 AAAGG and 1 CCTTT element in its 5' upstream region, sequences also found upstream of other stationary phase responsive genes mRNA splicing is regulated by Ire1p and only the product of spliced mRNA is able to induce the response	HAC1
HAP1	CYP1	YLR256W	Heme-dependent transcriptional activator of many genes	Increased activation of CYC1, CTT1, and CYB2; req. for expression of CYC7	CGGNNNTANCGG or CGG-N6-CGG UAS1-B consensus sequence: CGGNNTTNCGG TGGCCGGGGTTTACGGACGATGA (UAS1-B of CYC1) GCTAATAGCGATAATAGCGAGGG (UAS of CYC7)	Heme causes Hap1p to dimerize and dimer form binds to DNA Dimerization req. for DNA binding by Hap1p * In the absence of heme, Hap1p forms a complex at approximately 1,000 kDa, while in the presence of heme, Hap1p is monomeric	Polyglutamine domain (Gln9-Glu-Gln3) at residues 177-189 similar to polyglutamine domains in Hap2p Hap1p dimerization domain between residues 123 and 148 GAL4-type zinc finger domain at residues 64 - 86 Contains a Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region (2 chelated zinc atoms) * 7 repeats of a heme-binding motif, the Cys-Pro-Val (CPV) motif, between residues 280 - 420 * Heme regulation req. three domains: the dimerization domain, the heme domain and the HRM7 (heme-responsive motif 7) domain	HAP1
HAP2	.	YGL237C	Component of heterotrimeric CCAAT-binding factor	.	TNATTGGT (coding strand)	*Component of HAP (Hap2p-Hap3p-Hap4p-Hap5p) CCAAT-box-binding transcriptional activation complex	Highly conserved core region of 60 amino acids possess all the essential functions	HAP2
HAP3	.	YBL021C	Component of heterotrimeric CCAAT-binding factor	Together with Hap2p provides DNA binding function of HAP complex	Hap3p binds UAS2 of CYC1 in complex with Hap2p	*Component of HAP (Hap2p-Hap3p-Hap4p-Hap5p) CCAAT-box-binding transcriptional activation complex	.	HAP3
HAP4	.	YKL109W	Transcription factor with acidic activation domain Component of heterotrimeric CCAAT-binding facto	Involved in activation of CCAAT box-containing genes HAP(Hap2p-Hap3p-Hap4p-Hap5p) CCAAT-binding complex plays an important role in transcriptional induction under nonfermentative growth conditions, but has little effect during fermentative growth	.	*Component of HAP (Hap2p-Hap3p-Hap4p-Hap5p) CCAAT-box-binding transcriptional activation complex	2 AAAGG and 3 CCTTT elements, sequences which are also found in other stationary phase responsive genes, in its 5' upstream region Transcriptional activation subunit of HAP (Hap2p-Hap3p-Hap4p-Hap5p) CCAAT box-binding transcriptional activation complex Not req. for binding of complex to CCAAT box *Repressed 4-fold by glucose	HAP4
HAP5	.	YOR358W	Component of heterotrimeric CCAAT-binding facto	.	.	*Component of HAP (Hap2p-Hap3p-Hap4p-Hap5p) CCAAT-box-binding transcriptional activation complex Essential for binding activity of complex	*Evolutionarily conserved core domain (residues 154-240) sufficient for CCAAT-binding factor Hap2p-Hap3p-Hap5p assembly, but not for the recuitment of Hap4p into the CCAAT-binding complex	HAP5
HAT1	LPA16	YPL001W	Histone acetyltransferase, subunit 1	Acetylates lys12 of histone H4	.	Histone acetyltransferase B complex	.	HAT1
HAT2	.	YEL056W	Histone acetyltransferase subunit 2,	.	.	Histone acetyltransferase B complex	Seven WD (WD-40) repeats	HAT2
HCM1	.	YCR065W	Transcriptional suppressor	Dosage-dependent suppressor of CMD1	.	.	Member of the forkhead family of DNA-binding proteins with 50% identity across 86-residue DNA-binding region of forkhead family proteins Transcriptional activator domain	HCM1
HDA1	.	YNL021W	Component of histone deacetylase A, 75 kDa subunit	.	.	.	.	HDA1
HFI1	ADA1 SUP110 GAN1	YPL254W	Histone acetyltransferase	Interacts functionally with histone H2Ai	.	Component of SAGA transcriptional activator-histone acetyltransferase complex; SLIK (SAGA-like) complex	.	HFI1
HIF1	.	YLL022C	Factor iinteracting with histone acetyltransferase Hat1p	.	.	.	.	HIF1
HHF1	H4I	YBR009C	Histone H4	.	.	Histone octamer	Identical to Hhf2p	HHF1
HHF2	H4II CST22	YNL030W	Histone H4	.	.	Histone octamer	Identical to Hhf1p	HHF2
HHT1	H3I BUR5	YBR010W	Histone H3	.	.	Histone octamer	Identical to Hht2p	HHT1
HHT2	CST19 SIN2 H3II	YNL031C	Histone H3	.	.	Histone octamer	Identical to Hht1p	HHT2
HIR1	.	YBL008W	Histone transcription inhibitor	Req. for periodic repression of 3 of the 4 histone gene loci and for autogenous repression of HTA1-HTB1 locus by H2a and H2b Has overlapping functions with Hir2p but also has specific functions at the HTA1 promoter	Not a sequence-specific DNA-binding protein	*Functions as a transcriptional corepressor with Hir2p	Member of WD (WD-40) repeat family (7 copies of repeat at N-term) Two separate repression domains, an N-term repression domain containing the WD (WD-40) repeats and a C-term repression domain	HIR1
HIR2	SPT1	YOR038C	Histone transcription regulator 2	Req. for periodic repression of 3 of the 4 histone gene loci and for autogenous repression of HTA1-HTB1 locus by H2A and H2B May act on chromatin structure to repress transcription	Probably not a sequence-specific DNA-binding protein	.	Overlapping functions as a transcriptional repressor with Hir1p	HIR2
HIR3	HPC1	YJR140C	Histone transcription regulator 3	.	.	.	Member of a subfamily of WD-repeat-containing proteins (with Msi1p, Hat2p) that function in several histone-related processes including chromatin assembly and histone acetylation and deacetylation	HIR3
HMS1	.	YOR032C	Regulator of pseudohyphal differentiation	.	.	.	Probable transcription factor of the myc family Myc-type helix-loop-helix dimerization domain signature	HMS1
HPR1	(TRF1)	YDR138W	Hyperrecombination protein	Involved in maintaining stability of direct repeat sequences Acts as a positive transcription regulator of diverse genes Not responsible for the sequence-specific reduction in recombination between C1-3A/TG1-3 tracts near the telomere Not essential for DNA repair or meiosis not req. for general transcription activation	.	Part of complex of > 1 MDa different from SWI/SNF complex	*Has a nuclear transport motif	HPR1
HSF1	EXA3 MAS3	YGL073W	Heat shock transcription factor	Activator of heat-shock genes when it is not phosphorylated Involved in maintenance of nucleolar integrity *Plays a role in removing nucleosomes from transcription initiation site of HSP82 heat shock gene	Binds to the heat shock DNA element (HSE) at both normal and elevated temperatures nGAAnnTTCn and nTTCnnGAAn (mostly muliple boxes present)	Active as a trimer	N-term important for DNA binding C-term activation domain is dispensable for transient heat shock activation of SSA1 and SSA3 * Phosphorylation state changes during both heat and oxidative stress	HSF1
HST1	.	YOL068C	Protein similar to Sir2p	.	.	.	Member of SIR2 family	HST1
HST2	LPA2	YPL015C	Protein similar to Sir2p	.	.	.	Member of SIR2 family	HST2
HST3	.	YOR025W	Protein similar to Sir2p	.	.	.	Member of SIR2 family	HST3
HST4	.	YDR191W	Protein similar to Sir2p	.	.	.	Member of SIR2 family	HST4
HTA1	H2A1 SPT11	YDR225W	Histone H2A	.	.	Histone octamer	Identical to Hta2p	HTA1
HTA2	H2A2	YBL003C	Histone H2A	.	.	Histone octamer	Identical to Hta1p	HTA2
HTB1	H2B1 SPT12	YDR224C	Histone H2B	.	.	Histone octamer	.	HTB1
HTB2	H2B2	YBL002W	Histone H2B	.	.	Histone octamer	Nearly identical to Htb1p	HTB2
IME1	.	YJR094C	Transcription factor required for sporulation, positive regulator of IME2 and many sporulation genes	Stimulates nutritionally starved cells to sporulate Positive activator of transcription of SPO11, SPO13, IME2 and HOP1	T(A/G)G(C/G)CG(G/C)C(G/T)A See: Chu,S. et al., Science 282:699-705 (1998)	Interaction with Ume6p req. Mds1p Converts Ume6p from a repressor of URS1 sites to an activator of URS1 sites	Activation and DNA-binding domains in N-term region Upstream transcription controlling region contains four subdomains, UCS1-UCS4 (upstream transcription controlling region subdomain) UCS2 (-621 to -1369) contains both positive and negative regulatory elements UCS1 (-350 to -510) is involved in nutrient repression of IME1	IME1
IME2	(SME1)	YJL106W	Early meiosis regulator 2 ("Start of Meiosis")	.	.	.	.	IME2
IME4	SPO8	YGL192W	Positive transcription factor for IME1 and IME2	Mediates control of meiosis by carrying signals regarding mating type (a/alpha) and nutritional status	.	.	.	IME4
INO2	(SCS1) DIE1	YDR123C	bHLH-type transcription factor	Req. for transcriptional activation of phospholipid biosynthetic genes Ino2p-Ino4p-Opi1p regulate inositol repression of INO1, CHO1, CHO2, OPI3, ITR1, CKI1, HNM1, FAS1, FAS2, and ACC1	CATGTGAAAT element of which CANNTG is the canonical binding site for bHLH proteins	Complex with Ino4p (Fbf1 - FAS binding factor) is req. for binding to inositol/choline responsive element (ICRE) in promoters of phospholipid biosynthetic genes	C-term basic helix-loop-helix domain at position 253-291 N-term domain contains two separable transcription activation domains, TAD1 (residues 1-33) and TAD2 (residues 32-106)	INO2
INO4	HRF151	YOL108C	bHLH-type transcription factor	Involved in activation of phospholipid synthetic genes	.	Complex with Ino2p (Fbf1 - FAS binding factor) is req. for binding to inositol/choline responsive element (ICRE) in promoters of phospholipid biosynthetic genes	.	INO4
IXR1	(ORD1)	YKL032C	Intrastrand crosslink recognition protein and transcription factor	Confers oxygen (O2) regulation on COX5B	.	.	Several polyglutamine domains typical of transcription factors Has 2 HMG boxes	IXR1
KAR4	.	YCL055W	Regulatory protein	Required for pheromone induction of karyogamy genes	.	.	.	KAR4
KCS1	.	YDR017C	Inositol (1,2,3,4,5,6) hexaphosphate kinase	Suppressor of temperature-sensitive growth and hyperrecombination in pkc1-4	.	.	*2 potential leucine zipper domains	KCS1
KIN28	.	YDL108W	Cyclin-dependent ser/thr protein kinase	Component of transcription initiation factor TFIIH, phosphorylates C-terminal domain (CTD) of Rpo21p	.	RNA polymerase II general transcription factor TFIIH	.	KIN28
LEU3	.	YLR451W	Transcription regulator in branched chain amino acid biosynthesis pathways	Acts as both a repressor and an inducer	GCCGNNNNCGGC	.	Contains a basic region with repeated cysteine motif, similar to other DNA-binding proteins Peptide consisting of amino acids 17-147 containing the DNA-binding domain makes specific contact with the triplets	LEU3
LYS14	.	YDR034C	Transcriptional activator of lysin biosynthesis genes	.	WWWTCCRNYGGAWWW	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain within a cysteine-rich DNA-binding domain (N-term portion) Activation region in C-term domain *2-aminoadipate semialdehyde is a coinducer	LYS14
MAC1	CUA1	YMR021C	Transcription factor involved in induction of genes required for the reduction and utilization of iron and copper	.	.	.	.	MAC1
MAL13	.	YGR288W	Maltose pathway regulatory protein	.	.	.	Zn[2]-cys[6] fungal-type binuclear cluster domain	MAL13
MAL33	MAL3R	YBR297W	Maltose pathway regulatory protein	.	Sequence-specific DNA-binding transcriptional activator	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain 4 copies of a homologous sequence found at the MAL3 locus	MAL33
MATa1	A1 HMRA1 HMR MATA MAT1A	YCR097W	Homeodomain regulatory protein A1p	.	.	.	With Alpha2p, represses transcription of haploid-specific genes in diploid cells	MATa1
MATa2	A2 HMRA2	YCR096C	Regulatory protein A2p	.	.	.	No known function; sequence is the same as the last 119 residues of Alpha2p	MATa2
MAT-alpha1	.	YCR040W YCL066W	Regulatory protein Matalpha1p	*Activator together with MCM1/PRTF/GRM of alpha-specific genes in alpha cells	TCAATGNCAG (Q box of alpha-specific genes)	*With Mcm1p binds cooperatively to PQ DNA elements found upstream of alpha-specific genes	MAT alpha encodes alpha1 and alpha2 regulators which determine the alpha phenotype. MATa encodes a1 responsible for the a phenotype. In alpha-cells, a-specific genes are repressed while alpha-specific genes are expressed. Gene is an expressed copy of ALPHA1 translocated to the mating-type (MAT) locus during mating-type switching	MAT-alpha1
MAT-alpha2	HML ALPHA2 MAT2A	YCL067C YCR039C	Homeodomain regulatory protein MATalpha2p	Acts with Mcm1p to turn off a-specific genes. (ALPHA2 and MATALPHA2 have the same coding sequence, but ALPHA2 is silenced Req. for the precise positioning of nucleosomes adjacent to the Alpha2 operator in three different contexts	DNA-binding site for Alpha2p is a symmetrical 31-bp sequence with the center occupied by Mcm1p and the ends by Alpha2p dimers Binds to DNA as a dimer Binds half-sites of various spacing and orientation, but specific binding is determined after association with Mcm1p CATGTAANNNNNNNNNNNNNNNNNTTACAYG (alpha2 alone; at the alpha2 operator of a-specific genes) GCTTCCCAATGTAAAAGTACATCATAG (a1-alpha2 complex; MATalpha1promoter) YCRTGTNNWNANNTACATCA (MATa1, STE5, HO promoters) **More detailed upstream of a-specific promoters: CATGTAATTACCTAATAGGGAAATTTACACG (STE6) CATGTACTTACCCAATTAGGAAATTTACATG (STE2) CATGTAATTACCGAAAAAGGAAATT:ACATG (BAR1) TGTGTAATTACCCAAAAAGGAAATTTACATG (MFa1) CATGTATTTACCTATTCGGGAAATTTACATG (MFa2)	* Interactions with Mcm1p, Tup1p, and Ssn6p are req. for repression of MATa-specific genes Interactions with A1p, Tup1p, and Ssn6p are req.. for repression of haploid-specific genes Interactions with Mcm1p and Tup1p are req.. for proper donor selection of the silent mating-type loci In a/alpha cells, alpha2 also acts in combination with a1, to turn off the haploid specific genes. The binding of a1-alpha2 complex is different from that of alpha2 alone	Homeo domain Helix-turn-helix motif 2 nuclear localization (NLS) sequences, one in the amino terminal 13 amino acids and one within the homeodomain Homeobox domain sufficient for DNA binding in C-term region (residues 132-210) N-term domain (residues 1-131) req.. for protein protein interaction Gene is an expressed copy of ALPHA2 translocated to the mating-type (MAT) locus during mating-type switching *N-term 62 residues contains a signal, called Deg 1, that targets the protein for ubiquitin-dependent degradation through the UBC6/UBC7 proteolytic pathway	MAT-alpha2
MBP1	.	YDL056W	Transcription factor Subunit of Mbp1/Swi6 complex MBF	.	ACGCGTNA: MCB (MluI cell cycle box)	Collaborates with Swi6p to form the MBF (Mbp1p-Swi6p) factor	Two ankyrin repeats Regulates at Mlu1 cell cycle box (MCB) elements	MBP1
MBR1	.	YKL093W	Protein involved in mitochondrial biogenesis	.	.	.	.	MBR1
MCM1	PRTF GRM FUN80	YMR043W	Minichromosome maintenance factor 1	Transcription factor of the MADS (Mcm1p, Agamous, Deficiens, SRF) box family Activator of a-specific genes in a cells Co-activator with alpha1 of alpha-specific genes in alpha cells Co-repressor with alpha2 of a-specific in alpha cells Involved in repression of a-specific genes and activation of alpha-specific genes Target of osmotic stress-responsive signal transduction pathway Req. for repression of MATa-specific genes and proper donor selection during mating-type switching through its interaction with Alpha2p but not req.. for repression of haploid-specific genes *Activation of transcription through the early cell-cycle box (ECB) is maximal at M/G1 boundary	CCTAATTAGG (dyad-symmetry; in haploid-specific genes) Binding site for Mcm1p (early cell-cycle box, or ECB sequence) is required for timing of transcription and the transcription start-site selection * Binds to a transcription control element in Ty1 without participation of an associated DNA-binding protein Binds cooperatively with MATalpha1p to PQ elements in the promoter region of alpha-specific genes Binding sites found upstream of many genes including CLN3, CLB2, FAR1, PMA1, PIS1, DIT1, DIT2, GFA1, PCK1, MET2, CCP1, and HSP150	Acts with Alpha1p to turn off a-specific genes Binds DNA with Ste12p as a coactivator	Poly-asn and poly-gln stretches Recruits coregulatory proteins for both gene activation and repression at a variety of loci Fusion to a strong transcriptional activator causes transcription of genes such as SWI5, CLB1, CLB2, and CDC5 at inappropriate times MCM1 exerts control over G1 to S phase transition by regulating genes affecting CLN1 and CLN2 expression (SWI4 and CLN3) and genes that activate replication origins (CDC6, CDC46, CDC47) Loss of early cell-cycle box (ECB) delays transcription of SWI4, CLN1, CLN2, and CLN3 during cell cycle CDC6, CDC46, and CDC47 are req. for DNA replication and are all regulated by Mcm1p	MCM1
MCM2	.	YBL023C	Minichromosome maintenance factor 2 Member of the MCM/P1 family	.	.	Part of Mcm2p-Mcm3p-Cdc46p licensing complex MCM proteins are components of the pre-replication complex because association of MCM proteins with replication origins req. both Orc1p and Cdc6p function	C4-type zinc finger domain essential for function Shares a 200 amino acid domain containing the ATPase motif and DNA helicase domain with Mcm3p and Cdc46p *Complex acts at ARS's to initiate replication	MCM2
MCM3	SYGP-ORF23	YEL032W	Minichromosome maintenance factor 3 Member of the MCM/P1 family	.	.	Part of Mcm2p-Mcm3p-Cdc46p licensing complex	Shares a 200 amino acid domain containing the ATPase motif and DNA helicase domain with Mcm2p and Cdc46p Contains an ATPase and a helicase motif *Complex acts at ARS's to initiate replication	MCM3
MCM6	.	YGL201C	Minichromosome maintenance factor 6 Member of the MCM/P1 family	.	.	.	MCM family signature motif of MCM/P1 protein family includes Mcm2p, Mcm3p, Cdc46/Mcm5p, Cdc47p, Cdc54p, and Mcm6p	MCM6
MED1	.	YPR070W	Component of RNA polymerase II holoenzyme and mediator subcomplex	.	.	.	Mediator binds directly to a C-terminal domain (CTD) peptide and the CTD domain of Rpo21p is required for mediator function i	MED1
MED2	.	YDL005C	Component of RNA polymerase II holoenzyme and mediator subcomplex	.	.		.	MED2
MED3	PGD1 HRS1	YGL025C	Component of RNA polymerase II holoenzyme and mediator subcomplex	Involved in both positive and negative regulation	.	Two stable mediator subcomplexes can be detected by immnoprecipitation: Rgr1p-containing complex (Rgr1p, Gal11p, Sin4p, Srb7p, and Med1p, Med3p, Med4p, Med7p, Med8p and Med9p) and Med6p-containing complex (Med6p, Rox3p, Srb2p, Srb4p, Srb5p, and Srb6p) Transcription mediator complex contains Gal11p, Rgr1p, Sin4p, Srb4p, Med1p, Med2p, Pgd1p, Med4p, Med6p, Srb5p, Med7p, Med8p, Rox3p, Srb2p, Srb7p, Srb6p	.	MED3
MED4	.	YOR174W	Component of RNA polymerase II holoenzyme and mediator subcomplex	.	.	Mediator binds directly to a C-terminal domain (CTD) peptide and the CTD domain of Rpo21p is required for mediator function i	.	MED4
MED6	.	YHR058C	Component of RNA polymerase II holoenzyme and mediator subcomplex	.	.		.	MED6
MED7	.	YOL135C	Component of RNA polymerase II holoenzyme and mediator subcomplex	.	.	Mediator binds directly to a C-terminal domain (CTD) peptide and the CTD domain of Rpo21p is required for mediator function	.	MED7
MED8	.	YBR193C	Component of RNA polymerase II holoenzyme and mediator subcomplex	.	.	Mediator binds directly to a C-terminal domain (CTD) peptide and the CTD domain of Rpo21p is required for mediator function i	.	MED8
MED9	CSE2	YNR010W	Component of RNA polymerase II holoenzyme and mediator subcomplex	.	.		.	MED9
MED10	NUT2	YPR168W	See NUT2	.	.		.	MED10
MED11	.	YMR112C	Component of RNA polymerase II mediator (SRB) subcomplex	.	.	Mediator binds directly to a C-terminal domain (CTD) peptide and the CTD domain of Rpo21p is required for mediator function i Transcription mediator complex contains Gal11p, Rgr1p, Sin4p, Srb4p, Med1p, Med2p, Pgd1p, Med4p, Med6p, Srb5p, Med7p, Med8p, Rox3p, Srb2p, Srb7p, Srb6p, Cse2p/Med9p, Nut2p/Med10p, Nut1p, and Ymr112p/Med11p	.	MED11
MET4	.	YNL103W	Transcriptional activator of the sulfur assimilation pathway	*Involved in positive transcriptional regulation of Met2p, Met3p, Met5p, Met6p, Met14p, Met16p, and Met17p of the sulfate assimilation pathway	.	Cbf1p-Met4p-Met28p complex Interacts with Cbf1p and with Met28p through its leucine zipper	Member of basic leucine zipper (bZIP) family Met4p provides the transcriptional activation function to the Cbf1p-Met4p-Met28p complex *Involved in a mechanism whereby MET genes are induced when levels of S-adenosylmethionine are low	MET4
MET18	MMS19	YIL128W	Protein involved in nucleotide excision repair and transcription by RNA polymerase ii	Req. for both Pol II transcription and DNA repair Functions by influencing the activity of TFIIH as an upstream regulatory element	.	Not a component of TFIIH or Pol II holoenzyme	Contains a leucine-rich motif of 15 tandem repeats *Aspartokinase signature motif	MET18
MET28	.	YIR017C	Transcriptional activator of sulfur amino acid metabolism	.	AAACTGTG and adjacent sequence TCACGTG	*Met4p-Met28p-Met31p complex and Met4p-Met28p-Met32p complex assemble on the sequence AAACTGTG and are stabilized by the binding of Cbf1p to the adjacent sequence TCACGTG	Member of the basic leucine zipper (bZIP) family, works with Met4p and Cbf1p fos/jun DNA-binding homology domain Stimulates binding of Cbf1p to the promoter of MET16 by lowering the dissociation rate of the Cbf1p-DNA complex Does not possess intrinsic transcription activation function	MET28
MET30	.	YIL046W	F-box protein	Req. for S-adenosylmethionine inhibition of Met4p activation function Some alleles have a dominant inhibitory function	.	SCF-Met30p complex (Skp1p-Cdc53p-Cdc34p-Met30p) is required for Cdc34p-dependent ubiquitination and degradation of Cdk-inhibitory kinase Swe1p	5 WD (WD-40) repeats Contains a cyclin F box shared with Cdc4p, Grr1p, and six proteins of unknown function	MET30
MET31	.	YPL039W	Transcriptional regulator of methionine metabolism	.	AAACTGTG *Binds to a promoter sequence containing 5'-AAACTGTGG-3'	*Met4p-Met28p-Met31p complex and Met4p-Met28p-Met32p complex assemble on the sequence AAACTGTG and are stabilized by the binding of Cbf1p to the adjacent sequence TCACGTG	C2H2-type zinc finger domain in the C-term Both the bZIP domain and the amino acid residues 375 to 403 of Met4p are needed to assemble the Met4p-Met28p-Met31p complex on the sequence AAACTGTG	MET31
MET32	.	YDR253C	Transcriptional regulator of methionine metabolism	.	AAACTGTGG (see above)	*Met4p-Met28p-Met31p complex and Met4p-Met28p-Met32p complex assemble on the sequence AAACTGTG and are stabilized by the binding of Cbf1p to the adjacent sequence TCACGTG	C2H2-type zinc finger domain	MET32
MGA1	.	YGR249W	Protein similar to heat shock transcription factors	.	.	.	.	MGA1
MGA2	.	YIR033W	Probable chromatin remodeling factor	.	.	.	.	MGA2
MIG1	SSN1 CAT4	YGL035C	Transcriptional repressor involved in glucose-repression	.	GCGGGG WWWWSYGGGG Binds SUC2A and SUB2B DNA elements in vitro req.. for glucose repression of SUC2 Recognizes and binds to promoters of glucose-repressible genes and recruits co-repressor complex Tup1p-Ssn6p Binds to two GC rich regions in the SUC2 promoter (nt -505 to -483 and -451 to -426)	Model predicts that Mig1p is converted to non-repressing conformation upon activation of Snf1p/Snf4p protein kinase	Two C2H2 zinc finger domains at residues 34-61 and 62-91 Plays a role in glucose repression of MAL genes	MIG1
MIG2	MLZ1	YGL209W	Zinc-finger protein involved in glucose repression of SUC2	Req. for glucose repression of SUC2 expression Has little role in glucose repression of promoters other than SUC2 with Mig1p-binding sites	.	.	C2H2-type zinc finger domain; Mig1p, Mig2p, and Yer028p all have the same number and arrangement of zinc fingers ATP/GTP-binding domain (P-loop)	MIG2
MKS1	LYS80	YNL076W	Negative regulator of nitrogen metabolism	.	.	.	Involved in regulation of Ras-cAMP pathway and of lysine biosynthesis pathway,	MKS1
MOT1	BUR3 ADI	YPL082C	Transcriptional Accessory Protein (TAF)	Involved in transcriptional repression through interaction with TATA-binding protein (TBP)	.	.	Member of the Snf2p family of DNA helicases	MOT1
MOT2	SIG1 NOT4	YER068W	See SIG1	.	.	.	.	MOT2
MOT3	.	YMR070W	High-copy suppressor of MOT1-SPT3 synthetic lethality	.	.	.	Two tandem C2H2-type zinc fingers	MOT3
MSN1	FUP1 PHD2 MSS10 HRB382	YOL116W	Transcriptional activator	Activates genes regulated through Snf1p, involved in response to nutrient limitation Activates STA1, STA2, and STA3 transcription	.	.	.	MSN1
MSN2	.	YMR037C	Transcriptional activator for genes in multistress response and genes regulated through Snf1p	Thirty-nine gene products including ALD3, ALD3, GDH3, GLK1, HOR2, HSP104, HXK1, PGM2, SOD2, SSA3, SSA4, TKL2, TPS1, and ARA1 are dependent on Msn2p and Msn4p for their induction at the diauxic shift and are repressed by cAMP Both Msn2p and Msn4p are req. for transmitting glucose signals to the IME1 promoter region	STRE element (CCCCT)	.	Two C2H2-type zinc finger domains A region (residues 264-568) containing the PKA consensus site around Ser288 and sequences with strong similarity to Msn4p is req.. and sufficient to confer stress-regulated nuclear localization to reporter proteins Accumulates in the nucleus under stress conditions, such as heat shock, osmotic stress, carbon-source starvation, and in the presence of ethanol or sorbitol Nuclear localization is correlated inversely to cAMP levels and protein kinase A activity	MSN2
MSN4	.	YKL062W	Transcriptional activator	Thirty-nine gene products are dependent on Msn2p and Msn4p for their induction at the diauxic shift and are repressed by cAMP Both Msn2p and Msn4p are req. for transmitting glucose signals to the IME1 promoter region	.	.	Two tandem C2H2-type zinc finger domains near its C-term Predicted EF-hand calcium-binding domain (see MIPS)	MSN4
MTF1	RF1023	YMR228W	Mitochondrial RNA polymerase specificity factor	.	.	.	.	MTF1
MUB1	.	YMR100W	Factor involved in the regulation of bud site selection	.	.	.	Zinc-finger protein	MUB1
NCB2	YDR1	YDR397C	NC2 (Dr1/Drap1) repressor of class II transcription, beta subunit	.	.	Forms a heterodimer with human NC2alpha that is functional for transcriptional repression.	.	NCB2
NDT80	.	YHR124W	Transcription factor	Meiosis-specific protein required for exit from pachytene Dependent on IME1, which activates early sporulation genes	URS1: 5'TCGGCGGCTDW MSE: 5'HDVKNCACAAAAD See: Chu,S. et al., Science 282:699-705 (1998)	.	.	NDT80
NGG1	ADA3 SWI7	YDR176W	Component of the nucleosomal histone acetyltransferase (SAGA) complex	.	.	SAGA complex	.	NGG1
NIF3	.	YGL221C	Ngg1p-interaction factor	.	.	.	.	NIF3
NOT3	.	YIL038C	High-copy suppressor of cdc36 and cdc39mutations	Null mutants have phenotype similar to cdc36 and cdc39	.	CCR4 transcriptional complex contains Ccr4p, Pop2p, Dbf2p, Cdc39p, Cdc36p, Not3p, and Sig1p	.	NOT3
NRD1	.	YNL251C	Protein controling transcriptional elongation	.	.	Interacts with the C-terminal domain of RNA polymerase II large subunit and binds DNA through a RNA recognition (RRM) domain.	.	NRD1
NSP1	.	YJL041	Nuclear pore protein	.	.	.	.	NSP1
NUT1	.	YGL151W	Component of RNA polymerase II mediator (SRB) subcomplex	.	.	SRB complex	.	NUT1
NUT2	MED10	YPR168W	Subunit of RNA polymerase II holoenzyme mediator (SRB) subcomplex	.	.	SRB complex	.	NUT2
OAF1	YAF1	YAL051W	Transcription factor	Required for induction of POX1 on oleate-containing medium plays a role in peroxisome proliferation	.	Peroxisomal transcription factor complex	.	OAF1
OPI1	.	YHL020C	Negative regulator of phospholipid biosynthesis genes	Negative regulator of INO2 but not INO4 expression Ino2p, Ino4p, and Opi1p regulate inositol repression of INO1, CHO1, CHO2, OPI3, ITR1, CKI1, HNM1, FAS1, FAS2, and ACC1	.	.	.	OPI1
ORC1	.	YML065W	Origin recognition complex (ORC), large subunit	.	ORC complex binds to sequences A and B1 of DNA DNA-binding activity of the origin recognition complex (ORC) requires the coordinate action of Orc1p, Orc2p, Orc3p, and Orc5p, but not Orc6p All origin recognition complex (ORC) subunits bind chromatin throughout the cell cycle Origin recognition complex (ORC) subunits are in the major groove of ARS1 DNA	Origin recognition complex (ORC) is comprised of Orc1p, Orc2p, Orc3p, Orc4p, Orc5p, and Orc6p Interacts with C-term of Sir1p ORC is a component of the post-replication complex because ORC is also associated with origins at G2/M and this interaction is disrupted by ORC mutations ORC associates with replication origins throughout the cell cycle in vivo, whereas MCM proteins and Cdc45p act at origins in a very early step of replication *ORC bends ARS DNA at some but not all origins	N-term domain is req. for function of the origin recognition complex (ORC) in mating-type silencing *N-term domain is not req. for growth and therefore is probably not involved in DNA replication	ORC1
ORC2	RRR1 SIR5	YBR060C	Origin recognition complex (ORC), 72 kDa subunit	Functions early in DNA replication	See ORC1	See ORC1	Binds to the A element of the mating-type silencer region HMR, which contains the 11 bp consensus sequence req. at origins of DNA replication	ORC2
ORC3	.	YLL004W	Origin recognition complex (ORC), 62 kda subunit; 'Orc2p-associated factor'	.	See ORC1	See ORC1	.	ORC3
ORC4	.	YPR162C	Origin recognition complex (ORC), 56 kda subunit	.	See ORC1	See ORC1	.	ORC4
ORC5	.	YNL261W	Origin recognition complex (ORC), 50 kda subunit	Req. at G1/S and in early M phase Not req. for exit from mitosis, but req.. to begin S phase execution point for the G1/S function is between the nocodazole block in M phase and the START point in G1	See ORC1	See ORC1	.	ORC5
ORC6	(AAP1)	YHR118C	Origin recognition complex (ORC), sixth subunit	.	See ORC1	See ORC1	Phosphorylated as cells enter S phase Promoter has Mlu1 cell cycle box (MCB) elements	ORC6
PCL1	HCS26	YNL289W	G1/S-specific cyclin	.	.	Can interact with the Cdc28p-like kinase Pho85p	.	PCL1
PCL2	CLN4	YDL127W	Cyclin, found partly in association with Pho85p	.	.	.	.	PCL2
PCL5	.	YHR071W	Cyclin, associates with Pho85p	.	.	.	Member of Pcl1p,2p subfamily which includes Pcl1p, Pcl2p, Pcl5p, Pcl9p, and Clg1p	PCL5
PCL6	.	YER059W	Cyclin, associates with Pho85p	.	.	.	Member of Pho80p subfamily which includes Pcl6p, Pcl7p, Pcl8p, and Pcl10p	PCL6
PCL7	.	YIL050W	Cyclin, associates with Pho85p	.	.	.	.	PCL7
PCL8	.	YPL219W	Cyclin, associates with Pho85p	Involved in control of glycogen accumulation	.	.	.	PCL8
PCL9	.	YDL179W	Cyclin, associates with Pho85p	.	.	.	.	PCL9
PCL10	.	YGL134W	Cyclin, associates with Pho85p	Involved in control of glycogen accumulation	.	.	.	PCL10
PDR1	SCT1 CYH3 AMY1 ANT1 BOR2 NRA2 SMR2 TIL1 TPE1 (OLI1)	YGL013C	Transcription factor related to Pdr3p	Controls the expression of PDR5, SNQ2, STE6, PDR10, PDR11, YOR1, GAS1, IPT4, G3PD May have a role in regulation of PMA1 Positive regulator of PDR5 Positively regulates HXT9 and HXT11 transcription Regulates expression of PDR10 and PDR15 Can regulate level of Pdr3p (Delahodde A, Delaveau T, Jacq C, Yeast 11:S177, 1995) Details: Goffeau et al.	Binds to the Pdr1p/Pdr3p response element PDRE *Binds in vitro to 2 PDREs (PDR responsive elements) in the PDR10 and PDR15 promoters	Interacts with amino acids 274-307 of Ngg1p	Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-term region Posttranslationally upregulated by Pdr13p	PDR1
PDR3	(PDR4) (PDR7) AMY2 TPE3	YBL005W	Transcription factor related to Pdr1p	Positively regulates HXT9 and HXT11 transcription Regulates expression of PDR5, PDR10 and PDR15 Autoactivation is involved in the drug resistance phenomenon Positively autoregulates its own promoter with two binding sites *PDR3 and PDR1 cross-complement pdr1 or pdr3 mutants	Binds to an inverted palindrome spaced by 0 bp (CCGCGG) [PDRE]	Amino acids 1-373 of Ngg1p interacts with a domain of Pdr3p containing amino acids 756-976	Zn[2]-cys[6] fungal-type binuclear cluster domain in the N-term region Weak activation domain near the zinc finger and a strong activation domain near the C- terminus	PDR3
PHD1	.	YKL043W	Transcription factor involved in regulation of filamentous growth	.	.	.	Basic helix-loop-helix motif similarity to those of the transcription factors Pho4p and Cbf1p and mammalian Myc, Max, MyoD, and E47 Contains a 100-amino acid region, including a basic helix-loop-helix motif highly conserved in S. cerevisiae Phd1p and Sok2p	PHD1
PHO2	BAS2 GRF10	YDL106C	Homeodomain protein required for expression of phosphate pathway and other genes	.	Binds at A/T-rich sequences that flank UAS motifs; the UAS's bind other transcriptional regulators UAS: AAAWKAGTTAATTRAWT See: PHO5 regulation	Works in cooperation with Pho4p Cooperates with Swi5p to stimulate transcription with Bas1p participates in basal and induced regulation of purine pathway genes including ADE1, ADE2, ADE5,7 and ADE8	C-term domain req. for interaction with Pho4p Nuclear localization (NLS) sequence in the N-term region Pho2p and Pho4p are req. to activate the chromatin structure in the PHO5 promoter *Accessibility to its binding sites is increased by RAP1	PHO2
PHO4	.	YFR034C	bHLH-type transcription factor required for expression of phosphate pathway	*Pho4p is the primary trigger for the chromatin transition in the PHO5 promoter, while Pho2p either functions in the promoter by destabilizing histone-DNA interactions or by undergoing interactions with Pho4p	Binds to two UAS elements in the PHO5 promoter, UASp1 and UASp2 CACGTG Pho4p binds DNA as a homodimer *Binding to UASp2 elements is blocked by nucleosome -2 See: PHO5 regulation	Pho80p-Pho85p complex coimmunoprecipitates with Pho4p Pho80p interferes with Pho4p oligomerization and negatively controls transcription	Acidic region at N-term is req. for interaction with negative regulatory factor Pho80p Region responsible for Pho4p oligomerization and also for interaction with Pho80p lies between residues 172 and 227, and this region is req.. for transcriptional activity Cyrstal structure of two bHLH domains of Pho4p (each 63 amino acids) complexed to 17 bp of ds DNA has been determined and refined to a resolution of 2.8 Angstroms Nuclear localization signal is necessary and sufficient for PSE1-dependant nuclear import in vivo Hyperphosphorylation by Pho80p-Pho85p complex causes inactivation Phosphorylation of Pho4p prevents the expression of PHO5	PHO4
PHO23	.	YNL097C	Transcriptional regulator	Protein involved in chromatin remodeling and possibly transcription regulation Involved in expression of PHO5	.	Pho80p-Pho85p complex	.	PHO23
PHO80	TUP7 AGS3	YOL001W	Cyclin, interacts with Pho85p protein kinase to regulate the phosphate pathway through phosphorylation of Pho4p	Req. for inhibition of PHO5 and PHO11 transcription Not involved in regulating expression of PHO4 or PHO85	See: PHO5 regulation	Pho81p-Pho80p dissociate from Pho4p in low phosphate, but still interact with each other	Pho80p/Pho85p phosphorylates Pho4p at serines 100, 114, 128, 152, and 223 Pho81p functions upstream of Pho80p/Pho85p *Pho80-Pho85p phosphorylates Pho4p about 10-fold more effectively than Gsy2p, whereas Pcl10-Pho85p phosphorylates Gsy2p much more effectively than Pho4p	PHO80
PHO81	(SPL1)	YGR233C	Cyclin-dependent kinase (CDK) inhibitor for Pho80p-Pho85p complex, positive regulatory factor for phosphate pathway	Req. for synthesis of Pho5p Thought to sense the low-phosphate signal, perhaps at the transporter complex, followed by translocation into the nucleus to derepress the phosphate pathway	See: PHO5 regulation	Pho80p-Pho85p complex	141 amino acid segment from residue 584 to 724, including ankyrin repeats 5 and 6, has activity C-term domain positively regulates the activity of the functional domain N-term domain negatively regulates the activity of the functional domain 6 ankyrin repeats	PHO81
PHO85	SSG3	YPL031C	Cyclin-dependent protein kinase	Pho80p-Pho85p phosphorylates Pho4p at serines 100, 114, 128, 152, and 223 Pho80p-Pho85p phosphorylation of Pho4p inhibits Pho4p activity by localizing Pho4p to the cytoplasm	See: PHO5 regulation	Interacts with cyclin Pho80p to regulate phosphate pathway, also interacts with other Pho80p-like cyclins	.	PHO85
PHO86	.	YJL117W	Protein associated with phosphate transport complex	.	.		Regulates Pho81p activity	PHO86
PHO88	.	YBR106W	Membrane protein involved in inorganic phosphate transport	Regulates Pho81p function together with Pho86p	.		.	PHO88
PPR1	.	YLR014C	Transcription factor regulating pyrimidine pathway	Regulates pyrimidine pathway genes URA1, URA3, and URA4	CGG(N){2,11}CCG	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-terminal region	PPR1
PUT3	.	YKL015W	Transcriptional activator for proline utilization pathway genes	Req. for basal and induced expression of proline utilization enzymes Responds to proline levels but not to nitrogen excess or limitation	Binds to inverted CGG triplets spaced by 10 bp CGG(N){10}CCG	*Functions as a dimer and activates transcription with its negatively charged C-term	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region A peptide fragment of residues 31-126 containing the Zn[2]-Cys[6] binuclear cluster domain has the DNA-binding activity An acidic domain at the C-term has net charge of -29 Besides the DNA-binding domain is an acidic domain with net charge of -17 *Proline-responsive domain outside the C-term domain	PUT3
RAD1	.	YPL022W	Component of the nucleotide excision repairosome	.	.	NEF1, nucleotide excision repair factor 1 Repairosome complex	Homolog of human XPF xeroderma pigmentosum gene product and the mammalian ERCC-4 protein	RAD1
RAD2	.	YGR258C	Component of the nucleotide excision repairosome	Structure-specific single-stranded DNA endonuclease	.	NEF3, nucleotide excision repair factor 3 Repairosome complex	In the presence of active nucleotide excision repair (NER), TFIIH is preferentially mobilized from the basal transcription machinery for use in NER	RAD2
RAD3	.	YER171W	Component of the nucleotide excision repairosome	DNA helicase/ATPase of RNA polymerase II transcription initiation factor TFIIH	.	NEF3, nucleotide excision repair factor 3 Repairosome complex	.	RAD3
RAD4	.	YER162C	Component of the nucleotide excision repairosome	.	.	NEF2, nucleotide excision repair factor 2 Repairosome complex	Homolog of human XPC xeroderma pigmentosum gene product	RAD4
RAD5	REV2 SNM2	YLR032W	DNA helicase of the Snf2p family	Member of the RAD6 epistasis group, involved in error-free DNA repair	DNA-binding protein	Rad5p-Rad18p complex Ubc13p-Rad5p-Mms2p complex *Rad18p-Rad5p-Ubc13p complex		RAD5
RAD6	UBC2 PHL40	YGL058W	Ubiquitin conjugating enzyme involved in an error-prone DNA-damage recovery pathway	.	.	Rad6p-Rad18p complex	.	RAD6
RAD7	.	YJR052W	Nucleotide excision repair protein involved in G2 repair	.	.	Repairosome complex	Damaged DNA-bound Rad7p-Rad16p complex may serve as a nucleation site for assembly of other NER factors including NEF1, NEF2, NEF3, and replication factor A	RAD7
RAD10	.	YML095C	Component of the nucleotide excision repairosome	.	.	NEF1, nucleotide excision repair factor Repairosome complex	Homolog of mammalian ERCC-1 gene product	RAD10
RAD14	.	YMR201C	Component of the nucleotide excision repairosome	.	.	NEF1, nucleotide excision repair factor Repairosome complex	Zinc-binding protein Homolog of human XPA xeroderma pigmentosum gene product	RAD14
RAD16	PSO5	YBR114W	Nucleotide excision repair protein involved in G2 repair	Repair of inactive genes	.	Repairosome complex	*DNA helicase domain of Snf2p family	RAD16
RAD18	UVS18 UXS1 (MMS2)	YCR066W	Multifunctional DNA repair protein	Required for post-replication repair	.	Rad6p-Rad18p complex	.	RAD18
RAD23	.	YEL037C	Nucleotide excision repair protein	.	.	NEF2, nucleotide excision repair factor 2 Repairosome complex	Has a ubiquitin-like domain Ortholog of the human XP-C complementing gene products hHR23B and hHR23A	RAD23
RAD24	.	YER173W	Nucleotide excision repair protein	Checkpoint protein required for G2 arrest after DNA damage	.	RFC-like Rad24p complex	.	RAD24
RAD25	SSL2 LOM3 RTT4 UVS112	YIL143C	DNA helicase component of RNA polymerase II transcription initiation factor TFIIH	.	.	NEF3, nucleotide excision repair factor 3 Repairosome complex	.	RAD25
RAD26	.	YJR035W	Putative helicase involved in transcription-coupled repair	.	.	.	Homolog of Cockayne syndrome B gene ERCC-6	RAD26
RAD27	RTH1 ERC11 (FEN1)	YKL113C	Single-stranded DNA endonuclease and 5'-3' exonuclease	Functions in the MSH2-MLH1-PMS1-dependent mismatch repair system	.	.	.	RAD27
RAD28	.	YDR030C	Factor involved in transcription-coupled repair	.	.	.	WD (WD-40) repeats	RAD28
RAD30	RAD29 DBH1	YDR419W	DNA polymerase pol-eta	.	.	.	Can replicate efficiently past a thymine-thymine cis-syn cyclobutane dimer	RAD30
RAD50	.	YNL250W	Factor involved in recombinational DNA repair	.	.	RAD50-MRE11-XRS2 complex	Coiled-coil protein Needed for resection at double-stranded breaks and required for DNA repair during vegetative growth	RAD50
RAD51	MUT5	YER095W	Protein that stimulates pairing and strand-exchange between homologous single-stranded and double-stranded DNA	.	.	.	.	RAD51
RAD52	.	YML032C	Component of the recombinosome complex	.	.	Recombinosome complex	required for recombination and repair of X-ray damage, has a late function in meiotic recombination	RAD52
RAD54	.	YGL163C	DNA-dependent ATPase of the Snf2p family, required for recombination and repair of X-ray damage	.	.	.	.	RAD54
RAD55	.	YDR076W	Component of the recombinosome complex	.	.	Recombinosome complex	Involved in meiotic recombination and recombinational repair With Rad57p promotes DNA strand exchange by Rad51p recombinase	RAD55
RAD57	.	YDR004W	Component of the recombinosome complex	.	.	Recombinosome complex	Involved in meiotic recombination and recombinational repair With Rad55p promotes DNA strand exchange by Rad51p recombinase	RAD57
RAD58	MRE11 XRS4 NGS1	YMR224C	Single-stranded endonuclease and double-stranded exonuclease required for double strand break repair and meiotic recombination	.	.	.	.	RAD58
RAD59	.	YDL059C	Component of the recombinosome complex	.	.	Recombinosome complex	Homolog of Rad52p involved in homologous recombination and DNA repair	RAD59
RAP1	GRF1 (TUF1)	YNL216W	Repressor-activator protein	Major structural protein in the telomere Controls the transcription of most ribosomal protein genes	(A/G)(A/C)ACCCANNC-A(T/C)(T/C) RMACCCANNCAYY	Complexes with SIR proteins and repressed chromatin adjacent to telomeric DNA May participate in a complex containing Sir3p, Sir2p, Sir4p, Rap1p, Hht1p, Hht2p, Hhf1p, and Hhf2p on DNA adjacent to telomeres and/or TG1-3/C1-3A	DNA binding domain (residues 330-600) has no obvious similarity to any other DNA-binding motifs Req. for telomere length control and telomere position effect (silencing) *Residues 630-692 are sufficient for transcriptional activation, while residues 667-827 are sufficient for transcriptional silencing	RAP1
RCS1	AFT1	YGL071W	Transcriptional regulator	Regulates genes involved in iron uptake and control of cell size	.	.	.	RCS1
REB1	GRF2 (RBP1) QBP	YBR049C	rDNA enhancer binding protein 1 Termination factor for RNA polymerase I and transcription factor for RNA polymerase II	.	GT(A/C)CGGGTAA CCGGGTAA	TPI1, ILV1, GAL1-10, CDC9, TOP1, SWI5, 35SrRNA enhancer	N-term region can function as a transcriptional activator N-term region contains a glutamine-rich domain between residues 60 and 200 Acts in termination by causing RNA Polymerase I to pause Binding alters DNA conformation at initiation site *DNA-binding sites of Abf1p and Reb1p can functionally replace each other in different promoters	REB1
RFX1	.	YLR176C	DNA binding protein	Homologous to a family of mammalian RFX1-4 proteins which have a novel highly conserved DNA binding domain	.	.	.	RFX1
RGM1	.	YMR182C	Transcriptional repressor	Homologous to mammalian EGR (early growth response) factor	.	.	Proline-rich protein Two tandem C2H2-type zinc fingers	RGM1
RGR1	.	YLR071	Component of RNA polymerase II holoenzyme and Kornberg's mediator (SRB) complex	Proposed to either regulate the glucose transport genes or to inhibit their function Functions as a transcriptional repressor in the absence of glucose *Neutral function in transcriptional regulation of HXT2 and HXT4 in cells growing on low levels of glucose	Binds to promoter of HXT genes in the absence of glucose to repress transcription	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region Exerts positive and negative effects on transcription	RGR1
RGT1	.	YKL038W	Negative transcription factor involved in regulation of glucose transporters	.	Binds to promoter of HXT genes in the absence of glucose to repress transcription	??	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region Proposed to either regulate the glucose transport genes or to inhibit their function Functions as a transcriptional repressor in the absence of glucose *Neutral function in transcriptional regulation of HXT2 and HXT4 in cells growing on low levels of glucose	RGT1
RIC1	.	YLR039C	Transcription factor for ribosomal protein and ribosomal RNA genes	.	.	.	.	RIC1
RIM1	.	YCR028C-A	Single-stranded DNA-binding protein	.	.	.	Three C2H2-type zinc fingers Required for replication in mitochondria	RIM1
RIM101	(RIM1)	YHL027W	Factor involved in induction of IME1, IME2, DIT1, and DIT2 transcription	.	.	Acts in RIM1 pathway with Rim101p, Rim8p, Rim9p, and Rim13p (see SGD)	Zinc-finger protein RIM1 pathway functions in parallel to the Mck1p pathway by epistasis analysis (see SGD)	RIM101
RLM1	LPG19	YPL089C	Transcription factor of the MADS (Mcm1p, Agamous, Deficiens, SRF) box family	*Serum response factor-like protein that functions downstream of Mpk1p in MAP kinase pathway	CTA(T/A)4TAG	DNA-binding domains of Rlm1p and Smp1p can form heterodimers, which have an intermediate DNA-binding specificity	C-term domain is req.for transcriptional activation	RLM1
RME1	(CSP1)	YGR044C	Transcriptional repressor of meiosis in non-a/alpha cells	Inhibitor of meiosis and sporulation Blocks Ime1p expression Acts as a negative regulator of meiotic activator IME1 transcription Activates CLN2 expression *Does not mediate nutritional control of sporulation	GWACCTCAARA	Repressed by a1/alpha2 repressor Induced in non-a/alpha cells in stationary phase Trancription affected by regulator Sin3p	*Three Zn[2]Cys[6]-like domains at residues 178-199, 206-234, and 256-281 all three Zn[2]Cys[6] domains are req. for function	RME1
RMS1	(MRS1)	YDR257C	Putative transcriptional regulator	.	.	.	.	RMS1
ROX1	REO1	YPR065W	Heme-dependent transcriptional repressor of hypoxic genes including CYC7 and TIF51B/ANB1	.	12 base pair hypoxic consensus sequence YNNYYACCCG	.	Amino terminal portion has similarity to HMG proteins First 100 amino acids comprising HMG domain are responsible for DNA-binding C-term 75% of the molecule is involved in repression and contains redundant repression information *Expression is heme-dependent	ROX1
ROX3	SSN7 NUT3 ARE3	YBL093C	Component of RNA polymerase II holoenzyme and mediator subcomplex	Functions in both repression and activation of transcription Represses basal transcription of UAS-less genes, as does Sin4p	.		.	ROX3
RPA12	RRN4	YJR063W	RNA polymerase I subunit A12.2	.	.	.	.	RPA12
RPA14	.	YDR156W	RNA polymerase I subunit A14	.	.	.	.	RPA14
RPA34	CST21	YJL148W	Nonessential component of RNA-polI	.	.	.	.	RPA34
RPA43	.	YOR340C	RNA polymerase I subunit; not shared with other polymerases	.	.	.	.	RPA43
RPA49	.	YNL248C	RNA polymerase I third largest subunit	.	.	.	.	RPA49
RPA135	(RPA2) SRP3 RRN2	YPR010C	RNA polymerase I second largest subunit	.	.	.	.	RPA135
RPA190	RRN1	YOR341W	RNA polymerase I largest subunit	.	.	.	.	RPA190
RPB1	RPO21 SUA8 RPB220	YDL140C	RNA polymerase II, largest subunit	.	.	RNA Pol II core complex	.	RPB1
RPB2	RPB150 SIT2 SOH2	YOR151C	RNA polymerase II, second-largest subunit	.	.	RNA Pol II core complex	.	RPB2
RPB3	.	YIL021W	RNA polymerase II, third-largest subunit (B45)	.	.	RNA Pol II core complex	.	RPB3
RPB4	.	YJL140W	RNA polymerase II, fourth-largest subunit (B32),	.	.	RNA Pol II core complex	Non-essential subunit, confers stress tolerance	RPB4
RPB5	SPP51	YBR154C	Shared subunit of RNA polymerases I, II, and III (ABC27)	.	.	RNA Pol II core complex	.	RPB5
RPB6	RPO26	YPR187W	Shared subunit of RNA polymerases I, II, and III (ABC23)	.	.	RNA Pol II core complex	.	RPB6
RPB7	.	YDR404C	RNA polymerase II, non-essential subunit	.	.	RNA Pol II core complex	.	RPB7
RPB8	.	YOR224C	Shared subunit of RNA polymerases I, II, and III (ABC14.5)	.	.	RNA Pol II core complex	.	RPB8
RPB9	SSU73	YGL070C	RNA polymerase II, non-essential subunit, not shared	.	.	RNA Pol II core complex	.	RPB9
RPB10	.	YOR210W	Shared subunit of RNA polymerases I, II, and III (ABC10beta),	.	.	RNA Pol II core complex	Zinc-binding domain	RPB10
RPB11	.	YOL005C	RNA polymerase II, essential subunit, not shared	.	.	RNA Pol II core complex	.	RPB11
RPB12	RPC10	YHR143W-A	Shared subunit of RNA polymerases I, II, and III (ABC10alpha)	.	.	RNA Pol II core complex	Zinc-binding domain	RPB12
RPC10	RPB12	YHR143W-A	See RPB12	.	.	RNA Pol II core complex	.	RPC10
RPC11	.	YDR045C	RNA polymerase III subunit C11	.	.	.	Required for RNA cleavage activity and transcriptional termination	RPC11
RPC17	.	YJL011C	RNA polymerase III subunit C17	.	.	.	.	RPC17
RPC19	.	YNL113W	Shared subunit of RNA polymerases I and III	.	.	.	.	RPC19
RPC25	.	YKL144C	RNA polymerase III, subunit C25	.	.	.	.	RPC25
RPC31	RPC8 ACP2	YNL151C	RNA polymerase III, small subunit, essential subunit, not shared	.	.	.	.	RPC31
RPC53	RPC4	YDL150W	RNA polymerase III, fourth-largest essential subunit (C53)	.	.	.	.	RPC53
RPC82	RPC3	YPR190C	RNA polymerase III, third-largest subunit	.	.	.	.	RPC82
RPC128	RET1 RPC2; PDS2	YOR207C	RNA polymerase III, second-largest subunit (C128)	.	.	.	.	RPC128
RPC160	RPO31 RPC1	YOR116C	RNA polymerase III, largest subunit	.	.	.	.	RPC160
RPD3	IRS2 SDI2 SDS6 TSC9 REC3 CARGR3 CARGRIII CAR82	YNL330C	Component of histone deacetylase B	.	.	.	Transcriptional modifier required for full repression or full activation of many genes	RPD3
RPN4	SON1 PER8 UFD5 GVM1	YDL020C	Transcriptional activator of 26S proteasomal genes and genes related to the ubiquitin/proteasome pathway PACE catalog	.	GGTGGCAAA RPN4 and RPT genes	.	Unusual C2H2-finger protein Binds zinc Two acidic domains Subunit of the regulatory particle of the proteasome Binds to PACE-box to act as a positive regulator of expression	RPN4
RPO10	RPB12	YHR143W-A	See RPB12	.	.	.	.	RPO10
RPO21	RPB1 SUA8 RPB220	YDL140C	RNA polymerase II, 215 KD subunit	.	.		.	RPO21
RPO26	RPB6	YPR187W	Subunit shared by RNA Pol I, II and III (ABC23)	.	.		.	RPO26
RPO31	RPC1 RPC160	YOR116	RNA polymerase III, 160 KD (largest) subunit	.	.	.	.	RPO31
RPO41	.	YFL036	RNA polymerase, mitochondrial	.	.	.	.	RPO41
RRN3	.	YKL125	RNA polymerase I specific transcription factor	RNA polymerase I transcription factor	.	.	.	RRN3
RRN5	.	YLR141	RNA polymerase I specific transcription initiation factor	Component of the Upstream Activation Factor (UAF) complex, involved in activation of RNA polymerase I	.	.	.	RRN5
RRN6	.	YBL014C	RNA polymerase I specific transcription initiation factor	Component of RNA polymerase I core transcription factor (CF) along with Rrn7p and Rrn11p	.	.	.	RRN6
RRN7	.	YJL025W	RNA polymerase I specific transcription initiation factor	Component of RNA polymerase I core transcription factor (CF) along with Rrn6p and Rrn11p	.	.	.	RRN7
RRN9	.	YMR270C	.	Component of the Upstream Activation Factor (UAF) complex, involved in activation of RNA polymerase I	.	.	.	RRN9
RRN10	.	YBL025W	RNA polymerase I-specific transcription initiation factor	Component of the Upstream Activation Factor (UAF) complex, involved in activation of RNA polymerase I	.	.	.	RRN10
RRN11	.	YML043C	RNA polymerase I specific transcription initiation factor	Component of RNA polymerase I core transcription factor (CF) along with Rrn6p and Rrn7p	.	.	.	RRN11
RSC1	.	YGR056W	Component of RSC complex	RSC complex, which contains Rsc1p, catalzyes transfer of a histone octamer from a nucleosome to naked DNA, generating an octamer-DNA complex identical to a nucleosome	.	RSC, abundant chromatin remodeling complex	RSC complex has DNA-dependent ATPase and ATPase-dependent nucleosome-destabilization activities	RSC1
RSC2	.	YLR357W	Component of RSC complex	.	.	RSC, abundant chromatin remodeling complex	.	RSC2
RSC4	.	YKR008W	Component of RSC complex	.	.	RSC, abundant chromatin remodeling complex	.	RSC4
RSC6	.	YCR052W	Component of RSC complex	.	.	RSC, abundant chromatin remodeling complex	.	RSC6
RSC8	.	YFR037C	Component of RSC complex	.	.	RSC, abundant chromatin remodeling complex	.	RSC8
RTF1	.	YGL244W	Regulator of DNA binding properties of TBP	.	.	.	.	RTF1
RTG1	.	YOL067C	bHLH-type transcription factor	Involved in inter-organelle communication between mitochondria, peroxisomes, and nucleus	.	RTG transcription factor complex	Basic helix-loop-helix domain	RTG1
RTG3	.	YBL103C	bHLH-type transcription factor	Involved in inter-organelle communication between mitochondria, peroxisomes, and nucleus	.	.	Basic helix-loop-helix domain	RTG3
SAP18	.	YMR159C	Protein similar to human SIN3 complex component Sap18	Human homolog Sap18 interacts directly with human transcriptional repressor Sin3 implicated in subepidermal blistering	.	.	Possible coiled-coil protein Has similarity to AAA-proteins	SAP18
SAS2	.	YMR127C	Repressor protein	Protein involved in silencing at HMR	.	.	Single C2H2 finger	SAS2
SAS3	YBF2	YBL052C	Protein with histone acetyltransferase activity	Influences silencing at HMR locus Histone acetyltransferase activity toward histones H2A ,H3, and H4	.	Catalytic subunit of yeast NuA3 histone acetylase complex	Single C2H2-type zinc finger	SAS3
SAS4	.	YDR181C	Silencing factor	Protein involved in silencing at telomeres and the silent mating-type loci, HML and HMR	.	.	.	SAS4
SAS5	.	YOR213C	Silencing factor	Protein involved in silencing at telomeres and the silent mating type loci	.	.	.	SAS5
SAS10	.	YDL153C	.	Protein that derepresses HMR, HML and telomeres when overproduced	.	.	.	SAS10
SDS3	.	YIL084C	Transcriptional regulator	Suppressor of silencing defect	.	.	.	SDS3
SEF1	.	YBL066C	Protein with similarity to transcription factors	Involved in filamentous growth	.	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-term region MHR (middle homology region) motif conserved in most fungal Zn[2]-Cys[6] proteins	SEF1
SFL1	.	YOR140W	Transcriptional repressor	Transcriptional repressor interacting with SRB mediator subcomplex of RNA polymerase II; has domains homologous to myc oncoprotein and yeast Hsf1p	.	.	.	SFL1
SIG1	MOT2 (SSF1) NOT4 (CCL1)	YER068W	Transcriptional repressor involved in G-protein mediated pheromone signal transduction	*CCR4 transcriptional complex has both positive and negative effects on gene transcription	.	CCR4 transcriptional complex contains Ccr4p, Pop2p, Dbf2p, Cdc39p, Cdc36p, Not3p, and Sig1p May form a complex with Cdc36p/Not2p, Cdc39p/Not1p, and Not3p Physically associates with Not5p Interaction of Ccr4p with the NOT proteins is largely Pop2p-dependent *Interaction between Pop2p and the NOT proteins is Ccr4p-independent	C4-type zinc finger protein Involved in G-protein mediated pheromone signal transduction	SIG1
SIN3	SDI1 UME4 RPD1 CPE1 SDS16 GAM2	YOL004W	Transcriptional regulator with negative and positive effects on individual gene expression	.	Does not directly bind to DNA	.	Tertiary structure of protein contains four paired amphipathic helices (PAH) which are similar to helix-loop-helix and TPR repeat proteins Paired amphipathic helices are needed for transcription repressing activity Glutamine-rich region containing a run of alternating alanine and glutamine residues Eight potential glycosylation sites (NX(S/T)) Two potential PEST regions (residues 1089-1113 and 1495-1532) Regulates either directly or indirectly a wide range of genes, including SPO13, SPO11, TRK2, HO, PHO5, STA1, FUS1, STE2 STE3, and STE6 Req. for transcription of Adr6p which in turn is req. for STA1 and ADH2 expression Req. for full repression and full activation of PHO5, STE6, and TY	SIN3
SIN4	GAL22 TSF3 BEL2 SSN4 SDI3	YNL236W	Component of RNA polymerase holoenzyme and Kornberg's mediator subcomplex	Exerts positive and negative effects on transcription of individual genes Appears to affect global transcriptional regulation via effects on chromatin structure	Does not directly bind to DNA	Mediator complex consists of Gal11p, Sin4p, Rgr1p, Srb2p, Srb4p, Srb5p, Srb6p, Srb7p, Srb8p, Srb9p, Anc1p, Ssn8p, Ssn3p, and other proteins	Mediator binds directly to a C-term domain (CTD) peptide and the CTD domain of Rpo21p is Req. for mediator function in vitro *All genes activated by Sin4p are activated by Snf2p	SIN4
SIP1	.	YDR422C	Multicopy suppressor of SNF1	Negative regulator of GAL gene transcription Thought to act as an adaptor to promote activity of Snf1p for specific targets	.	May be part of complex with Mig1p and Ssn6p Snf1p-Snf4p interaction is bridged by a member of the Sip1p/Sip2p/Gal83p family *Interacts with the regulatory C-term domain of Snf1p through an internal region conserved in the Sip1p/Sip2p/Gal83p family	Conserved 80 amino acid sequence (ASC domain) in the C-term region that mediates interaction with Snf1p Interacts with Snf4p through the C-term ASC domain that is found in Sip1p, Sip2p, and Gal83p	SIP1
SIP2	.	YGL208W	Suppressor protein	Dominant suppressor of some temperature-sensitive mutations in RPO21 and PRP4, interacts with Snf1p	.	SNF1 protein kinase complex	Contains a predicted N-terminal myristylation site	SIP2
SIP4	.	YJL089W	Transcriptional activator of gluconeogenic genes through CSRE elements; activated by Snf1p kinase, possesses a Zn[2]-Cys[6] fungal-type binuclear cluster domain	Activity is regulated by glucose and depends on Snf1p activity Phosphorylated in response to glucose	.	.	Potential coiled-coil domain in the N-term region Leucine zipper in the C-term region *15% leucine and 12% asparagine	SIP4
SIR1	.	YKR101W	Silent mating-type regulator 1	Protein involved in establishment of silencing at HMR and HML, not required for establishment of telomere silencing Plays a role in regulation of ribosomal protein genes in response to mutations in the secretory pathway and in response to mild heat shock *Acts downstream of Orc1p in the silencing pathway	.	Complexes with other SIR proteins, Rap1p and histones H3 and H4 at telomeres for repression and subnuclear localization C-term interacts with Orc1p and Sir4p, but not Sir2p	.	SIR1
SIR2	MAR1	YDL042C	Silent mating-type regulator 2	Protein involved in maintenance of silencing of HMR, HML, and telomeres	.	May participate in a complex containing Sir3p, Sir2p, Sir4p, Rap1p, Hht1p, Hht2p, Hhf1p, and Hhf2p on DNA adjacent to telomeres and/or TG1-3/C1-3A *Directly interacts with Sir3p, Sir4p, and Sir2p itself in vitro	Potential zinc finger domain and two potential leucine zipper domains	SIR2
SIR3	MAR2 CMT1 STE8	YLR442C	Silent mating-type regulator 3	Protein involved in maintenance of silencing of HMR, HML, and telomeres see SIR4	.	May participate in a complex containing Sir3p, Sir2p, Sir4p, Rap1p, Hht1p, Hht2p, Hhf1p, and Hhf2p on DNA adjacent to telomeres and/or TG1-3/C1-3A *Interaction with histones H3 or H4 req. 2 domains involving amino acids 623-762 and 808-910	see SIR4	SIR3
SIR4	STE9 ASD1 UTH2	YDR227W	Silent mating-type regulator 4	Coiled-coil protein involved in maintenance of silencing of HMR, HML, and telomeres Req. for both the integrity and subnuclear localization of yeast telomeres Req. for Sir3p assembly at telomeric foci Req. for deletion by illegitimate recombination and DNA end-joining in the pathway involving Hdf1p Req. for efficient joining of DNA ends with short complementary sequences from linear plasmids Req. for silencing of silent mating loci HMR and HML in both diploid and haploid strains Sir2p, Sir3p, and Sir4p, but not Sir1p are req. for rejoining of broken DNA ends in vivo to repair DNA double strand breaks Targeting to an internal chromosomal site by addition of a heterologous DNA-binding domain is sufficient to establish silencing of nearby genes that is dependent on SIR2, SIR3, and SIR4	.	Sir3p and Sir4p both homodimerize and heterodimerize with each other May participate in a complex containing Sir3p, Sir2p, Sir4p, Rap1p, Hht1p, Hht2p, Hhf1p, and Hhf2p on DNA adjacent to telomeres and/or TG1-3/C1-3A Sir3p and Sir4p don't interact with histones H2A (Hta1p and Hta2p) or with histones H2B (Htb1p and Htb2p) Sir3p and Sir4p interact directly with the N-term regions of histones H3 (Hht1p and Hht2p) and H4 (Hhf1p and Hhf2p) Interacts with the C-term domain of Rap1p C-term half can bind Sir2p, Sir3p, Ubp3p, and a 69 kDa protein C-term domain interacts with Hdf1p C-term half interacts with the N-term half of Ris1p N-term domain inhibits its interaction with Sir3p	.	SIR4
SIS2	HAL3	YKR072C	.	Protein involved in ion homeostasis, plays a role in resistance to elevated NaCl or LiCl	.	.	Contains an extremely acidic C-terminal region	SIS2
SKN7	POS9 BRY1	YHR206W	Transcription factor	Homologous to response regulator proteins of bacterial 2-component systems and DNA-binding region of Hsf1p Probably involved in a two-component oxidative stress response regulation system Can activate G1 cyclins through the cell cycle box (CCB) element and Mlu1 cell cycle box (MCB) element Essential in the absence of SBF complex (Swi4p-Swi6p) and MBF complex (Mbp1p + Swi6p) Not involved in heat-shock response Probably regulates growth at the cell surface through a pathway that is parallel to the PKC1-MAP kinase pathway	.	Interacts with Rho1p and Cdc42p both in vivo and in vitro	Potential coiled-coil domain Potential "receiver motif" like those found in bacterial response regulators Receiver domain has no role in the oxidative stress response Mutation of aspartic acid residue in the receiver domain abolishes ability to suppress kre9 null mutation and to bypass SBF complex (Swi4p-Swi6p) mutations Response regulator domain is sufficient for gene activation ROCK-1/kinectin homology region is not req. for preventing growth of cdc42 at 35.5 deg, but req. for all other functions	SKN7
SKO1	.	YNL167C	Transcriptional repressor	Suppressor of protein kinase A (PKA) overexpression, homolog of mammalian ATF/CREB transcriptional repressor	DNA-binding protein	.	.	SKO1
SMP1	.	YBR182C	Transcription factor of the MADS (Mcm1p, Agamous, Deficiens, SFR) box family	.	ACTACTA(T/A)4TAG	*DNA-binding domain of Rlm1p and Smp1p can form heterodimers with an intermediate DNA-binding specificity	*Putative DNA-binding dimerization domain (MADS box)	SMP1
SNF1	CAT1 GLC2 CCR1 PAS14 HAF3	YDR477W	.	Serine/threonine protein kinase essential for derepression of glucose-repressed genes; acts with Snf4p	.	SNF1 protein kinase complex	.	SNF1
SNF2	SWI2 GAM1 TYE3 HAF1 (RIC1)	YOR290C	Component of SWI/SNF global transcription activator complex	.	.	SWI/SNF complex, see SNF11	Contains a bromodomain in the C-term region Bromodomain is not req. for activity Snf11p-interaction domain (domain 1) is conserved in Drosophila brahma and human hbrm and BRG1 gene products Helicase-related domain of Snf2p is necessary but not sufficient for transcriptional activation 7 motifs common to DNA-stimulated ATPases and DNA helicases *ATPase sequence is distinct from helicase-family sequences	SNF2
SNF4	CAT3	YGL115W	Protein involved in derepression of glucose-repressed genes, acts with Snf1p	Enhances the activity of Snf1p	.	Held in a complex with Snf1p by a member of the Sip1p/Sip2p/Gal83p family Association with Snf1p is regulated by glucose as determined by a two-hybrid test, indicating a possible conformational change Interacts with Sip1p, Sip2p, and Gal83p through the C-term ASC domain independent of Snf1p Snf1p kinase domain and Snf4p bind to overlapping but distinct regions of the C-term regulatory domain of Snf1p Interaction between Snf4p and the C-term regulatory domain of Snf1p occurs even in the presence of glucose, indicating that the N-term kinase domain influences the physiological interactions * In the presence of glucose, the N-term and the C-term domains of Snf1p interact with each other, suggesting that it is this interaction that prevents Snf1p from binding Snf4p in glucose	Contains 4 cystathionine-beta-synthase domains Associates with Snf1p in cells grown in both high and low levels of glucose *Autoinhibition of Snf1p kinase is antagonized by Snf4p	SNF4
SNF5	TYE4 HAF4 SWI10	YBR289W	Component of SWI/SNF global transcription activator complex	Acts to assist gene-specific activators through chromatin remodeling Req. for positive regulation of HO and SUC2	.	SWI/SNF complex, see SNF11	.	SNF5
SNF6	.	YHL025W	Component of SWI/SNF global transcription activator complex	*Req. for positive regulation of HO and SUC2	.	SWI/SNF complex, see SNF11	N-term contains a nuclear localization signal Protein highly charged (middle third has 40% charged residues) but contains roughly equivalent numbers of acidic and basic residues Extreme N-term is basic (8 of 1st 16 residues) and extreme C-term is acidic (10 of last 32 residues) Neither the C-term glutamine-rich region nor acidic region is absolutely req. for Snf6p function C-term third contains a glutamine-rich region (residues 264-276)	SNF6
SNF11	.	YDR073W	Component of SWI/SNF global transcription activator complex; acts to assist gene-specific activators through chromatin remodeling	Requirement of Snf2p for activating transcription varies depending on the promoter, the activator and the number of binding sites near the promoter Not req.. for cell cycle box factor (CCBF) complex formation *Req. for transcription of several inositol/choline-regulated genes involved in phospholipid biosynthesis, including CHO1, CHO2, OPI3, CKI1, and INO1	.	SWI/SNF complex includes Swi1p, Snf2p, Swi3p, Snf5p, Snf6p, Snf11p, Swp59p, Swp61p, Swp73p, Swp82p, Anc1p, and other proteins Complex appears to act through altering interaction of H2A-H2B with DNA copies per cell Complex is present at only about 100 copies per cell Only about 10 genes are needed to acquire Swi/Snf complex for activation Purifies with a complex of 2 MDa (21183) SWI-SNF complex introduces positive supercoils into circular DNA in the presence of bacterial topoisomerase I; changes in linking number are large (greater than 10) even when the complex and plasmid are in one-to-one ratio Ability of the SWI-SNF complex to introduce supercoils into circular DNA Requires topoisomerase, but does not require ATP ADA/GCN5 may function together with SWI/SNF to facilitate transcription or regulate SWI/SNF activity at only a subset of genes SWI/SNF complex is req.. for Gal4p to bind to and function at low-affinity nucleosomal binding sites in vivo, but not at the nucleosome-free binding site ADA/GCN5 may function together with SWI/SNF to facilitate transcription or regulate SWI/SNF activity at only a subset of genes	28% Asn + Gln 6 repeats of NA (T/N)A Req. for transcription of HO, INO1, ADH1, ADH2, SUC2, GAL1, GAL10 Requires an intact nucleotide-binding motif for efficient transcriptional activation, suggesting that NTP hydrolysis is a normal function of Snf2p 27kDa ICL1 promoter binding protein requires Snf2p for binding Not req. to activate reporter gene fused to cell cycle box (CCB) sequences (8469) Stimulates transcription of INO1 gene by counteracting the function of negative regulator Spt2p ADA/GCN5 may function together with SWI/SNF to facilitate transcription or regulate SWI/SNF activity at only a subset of genes * Not req. for chromatin remodeling at the PHO5 gene Involved in coordinate regulation of phospholipid synthesis Plays a role in nucleosome positioning in SUC2 promoter *Plays a role in nucleosome positioning in HIS4 promoter	SNF11
SNF12	SWP73	YNR023W	Component of SWI-SNF global transcription activator complex	Acts to assist gene-specific activators through chromatin remodeling	.	SWI/SNF complex	.	SNF12
SOK2	.	YMR016C	Protein that can suppress mutants of cAMP-dependent protein kinase when overexpressed	.	.	.	.	SOK2
SPO1	.	YNL012W	Transcriptional regulator involved in sporulation	.	.	.	Strong similarity to phospholipase B enzymes Req. for middle and late meiotic gene expression, meiotic chromosome segregation, spindle pole body duplication (Tevzadze GG, Esposito RE, Yeast 11:S126, 1995) Not req. for vegetative growth *May act to regulate the expression of middle/late meiotic genes SPS2 and DIT1 (Tevzadze GG, Esposito RE, Yeast 11:S126, 1995)	SPO1
SPS18	SPX18	YNL204C	Sporulation-specific zinc finger protein involved in activation of sporulation; member of Gcs1p/Glo3p/Sps18p family	.	.	.	Contains one Glo-type CXXCX10CXXC (C2H2-type) zinc finger in N-term Potential nuclear localization (NLS) sequence Not induced by oleate, whereas SPS19 is induced by oleate UAS element which requires Ime2p for activation, is independent of Ume6p, and which is identical to the mid-sporulation element MSE	SPS18
SPT2	SIN1	YER161C	HMG-like chromatin protein	Negative regulator of HO gene transcription Negative regulator of transcription of INO1 Acts as a negative transcriptional regulator, but can under certain conditions act as a positive regulator May play a role in the fidelity of chromosome segregation, since sin1 mutants exhibit increased loss of chromosome III, but not chromosome V	Binds DNA non-specifically probably due to its high positive charge	Interacts with Cdc23p in vivo and in vitro Interacts with Snf1p through a conserved domain	C-term portion of Spt2p is responsible for interaction with a protein that binds to the regulatory region of HO N-term portion of Spt2p associates with the part of Cdc23p containing tetratricopeptide (TPR) repeats HMG-box motif is req. for function and for dominant suppressor phenotype HMG-box motif in the middle of the molecule has DNA-binding properties *N-term DNA-binding domain has at least one acetylation site	SPT2
SPT3	.	YDR392W	Component of the nucleosomal histone acetyltransferase (SAGA) complex, member of TBP class of SPT proteins	Req. for transcription from certain promoters including Ty1 and Ty2 Req. to maintain optimal levels of functional centromere DNA-binding proteins Acts synergistically with Rsp5p to potentiate hormone-dependent transcriptional activation probably as coactivators Both ADA and SPT family members are independently req. for the presence and activity of the nucleosomal histone acetyltransferase (Spt-Ada-Gcn5-Acetyltransferase: SAGA) complex	Does not bind DNA	Interacts with TATA-binding protein (TBP/Spt15p) but does not bind DNA 1.8 mDa nucleosomal histone acetyltransferase complex contains Gcn5p, Ada2p, Ngg1p, Spt7p, Spt20p, Spt3p, and Spt8p SAGA transcriptional activator-histone acetyltransferase complex [E]; SLIK (SAGA-like) complex [E]; SAGA complex	.	SPT3
SPT4	.	YGR063C	Protein involved in chromatin structure that influences expression of many genes	May be involved in transcription initiation Important for kinetochore function, but not as a structural component of the CEN DNA-protein complex Role in the function of Hir1p as a transcriptional repressor via the seven WD (WD-40) repeats of Hir1p Homologous human Spt4-Spt5 complex is also a transcription elongation factor in vitro	.	Part of a complex with Spt5p and Spt6p Spt4p/Spt5p/Spt6p complex may form a complex with histone H2A and H2B which can repress transcription No detectable binding to Spt6p in vitro Binds to Spt5p strongly in vitro *Spt4p-Spt5p complex binds RNA pol II including Rpo21p	Has a zinc finger	SPT4
SPT5	.	YML010W	Protein involved in chromatin structure that influences expression of many genes	Has a role in the function of Hir1p as a transcriptional repressor via the seven WD (WD-40) repeats of Hir1p	.	Spt4p/Spt5p/Spt6p complex may form a complex with histone H2A and H2B which can repress transcription Part of a complex with Spt4p and Spt6p Strongly binds to Spt4p but weakly to Spt6p in vitro *Spt4p-Spt5p complex binds RNA pol II including Rpo21p SPT4-SPT5-SPT6 transcription factor complex	Acidic N-term and repeats of S-T/A-W-G-G-A/Q in the C-term	SPT5
SPT6	SSN20 CRE2	YGR116W	Protein involved in chromatin structure that influences expression of many genes	Role in the function of Hir1p as a transcriptional repressor via the seven WD (WD-40) repeats of Hir1p Homologous human Spt4-Spt5 complex is also a transcription elongation factor in vitro	.	Part of a complex with Spt5p and Spt6p Spt4p/Spt5p/Spt6p complex may form a complex with histone H2A and H2B which can repress transcription *Interacts strongly with globular domain of histone H3 and weakly with histone H4-SPT4-SPT5-SPT6 transcription factor complex	.	SPT6
SPT7	GIT2	YBR081C	Component of the nucleosomal histone acetyltransferase (SAGA) complex	Both ADA and SPT family members are independently req. for the presence and activity of the nucleosomal histone acetyltransferase (SAGA) complex	.	1.8 mDa nucleosomal histone acetyltransferase complex contains Gcn5p, Ada2p, Ngg1p, Spt7p, Spt20p, Spt3p, and Spt8p	*Bromodomain not req. for activity	SPT7
SPT8	.	YLR055C	Component of the nucleosomal histone acetyltransferase (SAGA) complex, member of TBP class of SPT proteins	.	.	1.8 mDa nucleosomal histone acetyltransferase complex contains Gcn5p, Ada2p, Ngg1p, Spt7p, Spt20p, Spt3p, and Spt8p *Involved in an interaction between Spt3p and Spt15p	*Highly acidic amino terminus, with 49 of the first 76 amino acids being aspartate or glutamate	SPT8
SPT10	CRE1 SUD1	YJL127C	Protein that amplifies the magnitude of transcriptional regulation at various loci	.	.	.	.	SPT10
SPT15	TBP1; TBP BTF1 TFIID	YER148	Component of RNA polymerases I, II, and III; part of initiation factors TFIID and TFIIIB	.	.		.	SPT15
SPT20	ADA5 AOE555	YOL148C	Component of the nucleosomal histone acetyltransferase (SAGA) complex, member of TBP class of SPT proteins	Involved in the same pathway as the other ADA genes but has amore general function in transcription Req. for the maximal activation of the unfolded protein response (UPR) but not for the heat shock response of genes such as KAR2 and PDI1 Both ADA and SPT family members are independently req. for the presence and activity of the nucleosomal histone acetyltransferase (SAGA) complex ADA/GCN5 may function together with SWI/SNF to facilitate transcription or regulate SWI/SNF activity at only a subset of genes *Req. for efficient mating	.	Part of the ADA complex including Hfi1p, Ada2p, Ngg1p, Spt20p, and Gcn5p 1.8 mDa nucleosomal histone acetyltransferase complex contains Gcn5p, Ada2p, Ngg1p, Spt7p, Spt20p, Spt3p, and Spt8p May associate with Spt5p *Physically associates with Spt3p, Spt7p, Spt8p, and Spt15p, but not with Toa2p or Rpb1p	Gln-rich, Ser-rich, and has acidic domain	SPT20
SPT21	BUR4	YMR179W	Protein that amplifies the magnitude of transcriptional regulation at various loci	*Req. for transcription at HTA2-HTB2 and HHF2-HHT2, but not at the other two histone loci	.	.	.	SPT21
SPT23	.	YKL020C	Transcription factor	Required for transcription of a subset of genes; functionally redundant with Mga2p Both Spt23p and Mga2p may function by remodeling chromatin structure, like Snf2p and Snf5p	.	.	Both Spt23p and Mga2p contain at least two ankyrin repeats Transactivation domain is located between residues 26-75, which is acidic, nonhomologous to Mga2p, and req. for all its in vivo functions	SPT23
SRB2	HRS2	YHR041C	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	.	.		.	SRB2
SRB4	.	YER022W	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	.	.		.	SRB4
SRB5	.	YGR104C	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	.	.		.	SRB5
SRB6	.	YBR253W	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	.	.		.	SRB6
SRB7	.	YDR308C	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	.	.		.	SRB7
SRB8	NUT6 SSN5 GIG1 (ARE2)	YCR080W YCR081W	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	.	.		.	SRB8
SRB9	(NUT8) SCA1 SSN2 UME2	YDR443C	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	.	.		.	SRB9
SRB10	SSN3 UME5; NUT7 (ARE1) GIG3	YPL042C	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	Cyclin-dependent serine/threonine protein kinase	.		.	SRB10
SRB11	SSN8 UME3 (NUT8) GIG2	YNL025C	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	Cyclin C homolog	.		.	SRB11
SSL1	.	YLR005W	TFIIH subunit (transcription initiation factor), factor B	.	.		.	SSL1
SSL2	RAD25 LOM3 RTT4 UVS112	YIL143C	DNA helicase component of RNA polymerase II transcription initiation factor TFIIH	.	.		.	SSL2
SSN3	SRB10	YPL042C	.	.	.	.	.	SSN3
SSN6	CYC8 CRT8	YBR112C	General repressor of transcription	Req. for repression of SUC2 expression mediated by upstream repression sequence URS[SUC2] Req. for repression of haploid-specific genes and MATa-specific genes through its interaction with Alpha2p, but not req. for proper donor selection during mating-type switching	Complex is brought to target promoters by sequence-specific DNA-binding proteins	Tup1p-Ssn6p complex is estimated to be 440 kDa in size, previously reported to be part of a complex of 1,200 kDa Tup1p-Ssn6p complex has about one Ssn6p and three Tup1p molecules according to densitometry of stained SDS gels, previously reported as 1:4 ratio TPR region interacts specifically with the homeodomain of Alpha2p	10 tetratricopeptide (TPR) repeats Protein functions with all but 3 or 4 of the 10 tetratricopeptide (TPR) repeats removed N-term of Tup1p is req. for its oligomerization and association with Ssn6p Tetratricopeptide (TPR) repeats 1-3 interact with Tup1p and are req. for repression of the a-specific genes Tetratricopeptide (TPR) repeats 4-7 are req. for the regulation of aerobically repressed genes Tetratricopeptide (TPR) repeats 8-10 are req. for regulation of the glucose repressed genes N-term is req. for its oligomerization and association with Ssn6p	SSN6
SSN8	SRB11	YNL025C	RNA polymerase II holoenzyme and Kornberg's mediator (SRB) subcomplex subunit	Cyclin C homolog	.	.	.	SSN8
SSU72	.	YNL222W	Protein interacting with TFIIB (Sua7p)	Influences RNA polymerase II start-site selection in sua7 mutants	.	.	.	SSU72
STB1	.	YNL309W	Sin3p-binding protein	*Involved in transcription regulation at START in the absence of Cln3p	.	Componet of SIN3 complex	.	STB1
STB2	.	YMR053C	Sin3p-binding protein	.	.	Componet of SIN3 complex	.	STB2
STB3	.	YDR169C	Sin3p-binding protein	.	.	Componet of SIN3 complex	.	STB3
STB4	.	YMR019W	Sin3p-binding protein	.	.	Componet of SIN3 complex	Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-terminal region	STB4
STB5	.	YHR178W	Protein with similarity to transcription factors	.	.	Componet of SIN3 complex	.	STB5
STB6	.	YKL072W	Sin3p-binding protein	.	.	Componet of SIN3 complex	.	STB6
STE12	.	YHR084W	Transcription factor that binds to pheromone response element (PRE)	Regulates genesrequired for mating, also functions with Tec1p to regulate genes required for filamentous growth Acts downstream of STE11 and RAS2 Phosphorylation in response to pheromone treatment is dependent upon a functional pheromone response MAP kinase pathway (29504) Req. for induction of TEC1 transcription Function of the sterile response element (SRE) in Ty1 is dependent on Ste12p and Req. for FLO11 expression Promotes pheromone-responsive transcription as a homomultimer Req. for pseudohyphal growth of nitrogen-starved diploid cells Req. for invasive growth into agar and filamentous growth in haploids Functions with Tec1p to induce pseudohyphal growth	Pheromone-response (PRE) element (TGAAAC)	Mcm1p is a coactivator for DNA-binding by Ste12p Binds cooperatively with Tec1p to elements of the promoter termed filamentation and invasion response elements (FREs) Interacts with alpha1 protein to induce transcription of alpha-specific (a-factor-inducible) genes Directly inhibited by Dig1p and Dig2p Association with Fus3p requires Dig1p and Dig2p Maximum transcription activation of target genes by Ste12p requires a synergistic interaction between the pheromone induction domain and the transcription activating domain of Ste12p Mcm1p is a coactivator for DNA-binding by Ste12p Binds cooperatively with Tec1p to elements of the promoter termed filamentation and invasion response elements (FREs) Interacts with alpha1 protein to induce transcription of alpha-specific (a-factor-inducible) genes Directly inhibited by Dig1p and Dig2p Association with Fus3p requires Dig1p and Dig2p Maximum transcription activation of target genes by Ste12p requires a synergistic interaction between the pheromone induction domain and the transcription activating domain of Ste12p	Degenerate homeodomain sequence in the DNA-binding region N-term 215 amino acids is responsible for DNA binding * C-term domain interacts with Mcm1p Human SRF can bind to Ste12p if its sequence is modified in a specific domain that is shared with yeast Mcm1p C terminal residues 384 to 688 are important in both basal and induced transcription activation activity Residues 216 to 383 are necessary for proper transcription induction of target genes in response to pheromone, and is called the Pheromone Induction Domain Residues 301 to 335 are sufficient to confer responsiveness to the pheromone response cascade on a chimeric transcriptional activator protein Tyrosine residues at positions 310 and 317 are essential for repression of transcription activating activity in the absence of pheromone Dig1p and Dig2p bind to residues 301-317 of the pheromone response domain of Ste12p and inhibit its transcription activating activity Heavily phosphorylated prior to pheromone treatment Pheromone-treatment induces novel phosphorylations on Ste12p Phosphorylated on Ser and Thr in both pheromone-treated and untreated cells Phosphorylations on Ste12p that occur in response to pheromone treatment are only a minor proportion of the total phosphorylations on Ste12p Tryptic phosphopeptide analysis of Ste12p from cells not treated with pheromone generates seven major and one minor phosphopepetide Tryptic phosphopeptide analysis of Ste12p from pheromone-treated cells generates two new minor phosphopeptides in addition to the eight phosphopeptides observed in untreated cells	STE12
STH1	NPS1	YIL126W	Component of chromatin remodeling complex (RSC)	DNA helicase of the Snf2p family	.	RSC, abundant chromatin remodeling complex	*Has a bromodomain	STH1
SUA7	SOH4 TFIIB	YPR086W	RNA polymerase II transcription initiation factor TFIIB (factor e)	*Functions in selection of site for transcription	.	.	.	SUA7
SUB1	TSP1	YMR039C	Transcriptional coactivator	May be involved in the release of TFIIB from the transcription complex during RNA polymerase II transcription	.	.	.	SUB1
SWI1	ADR6 GAM3 LPA1	YPL016W	Component of SWI/SNF global transcription activator complex	Acts to assist gene-specific activators through chromatin remodeling SWI-SNF complex and ATP can increase nucleosomal DNA accessibility 100-fold and remodel one nucleosome every 4.5 min on an 11-mer nucleosome array SWI/SNF complex is req. for Gal4p to bind to and function at low-affinity nucleosomal binding sites in vivo, but not at the nucleosome-free binding site Req. for expression of STA1 Req. for expression of SUC2, GAL1, GAL10, HO, INO1 and other genes Req. for transcription of ADH1 and ADH2 Swi-Snf may antagonize Ssn6p-Tup1p by controlling chromatin remodeling activity	.	SWI/SNF complex includes Swi1p, Snf2p, Swi3p, Snf5p, Snf6p, Snf11p, Swp59p, Swp61p, Swp73p, Swp82p, Anc1p, and other proteins Complex appears to act through altering interaction of H2A-H2B with DNA copies per cell * Complex is present at only about 100 copies per cell Only about 10 genes are needed to acquire Swi/Snf complex for activation Purifies with a complex of 2 MDa (21183) SWI-SNF complex introduces positive supercoils into circular DNA in the presence of bacterial topoisomerase I; changes in linking number are large (greater than 10) even when the complex and plasmid are in one-to-one ratio Ability of the SWI-SNF complex to introduce supercoils into circular DNA Requires topoisomerase, but does not require ATP *ADA/GCN5 may function together with SWI/SNF to facilitate transcription or regulate SWI/SNF activity at only a subset of genes	Highly acidic N-term domain Polyglutamine domain and polyasparagine regions	SWI1
SWI2	SNF2 GAM1 TYE3 HAF1 (RIC1)	YOR290C	see SNF2	.	.	SWI/SNF complex, see SWI1	.	SWI2
SWI3	TYE2	YJL176C	Component of SWI/SNF global transcription activator complex	Acts to assist gene-specific activators through chromatin remodeling	.	SWI/SNF complex, see SWI1	Contains a SANT domain, which is common to Swi3p, Ada2p, Tfc5p, Isw1p, and Rsc8p	SWI3
SWI4	ART1	YER111C	Transcription factor	Both Swi4p and Swi6p are req.. for the in vivo protection of the Swi4p-Swi6p-dependent cell cycle box (SCB) sequences at any cell cycle stage Repression function of the SBF complex (Swi4p + Swi6p) may be regulated by the Cln2-Cdc28 kinase Neither SWI4 nor SWI6 are Req. for activation of POL1 transcription through Mlu1 cell cycle box (MCB) sequences Both SWI4 and SWI6 are necessary in cells with CLN3 as only functional cyclin to promote passage through START CLN1 function is strongly dependent upon SWI4, and somewhat dependent upon SWI6 CLN2 function is dependent upon SWI4, not but SWI6, function PCL1 transcription is regulated by the G1-specific transcription factor Swi4p Activates the unfolded protein response (UPR) pathway CLN2 contains three versions of SCB (Swi4p-dependent cell-cycle box) that are bound by a Swi4p and Swi6p containing complex *An oligo which bears a SCB (Swi4p/Swi6p Cell cycle Box) element binds two different Swi4p-Swi6p complexes (U: upper and L: lower)	Binds to cell cycle box sequence CACGAAAA upstream of HO Swi4p, but not Swi6p, can bind SCBs (Swi4p/Swi6p Cell cycle Box) alone Binds with Swi6p to a cluster of 3 sequences in the CLN1 promoter which resemble MCB elements	Collaborates with Swi6p to form the SBF (Swi4p + Swi6p) factor for regulation at the cell cycle box (CCB) element Protein complexes observed to specifically bind the Mlu1 cell-cycle box (MCB) are SWI6 dependent but SWI4 independent Swi4p and Swi6p associate through their C-termini Neither the leucine zipper motif nor the ankryin repeats of Swi6p are req. for Swi6p to interact with Swi4p *Ankyrin repeats mediate the interaction with Clb2p-Cdc28p protein kinase complex	2 ankyrin repeats Ankyrin motif of Swi4p is req. for in vivo function Ankyrin repeats are also called TPLH repeats, Cdc10-Swi6 repeats, notch repeat, and SWI6-ANK repeats C terminus is sufficient for interaction with Swi6p in vitro DNA binding domain of Swi4p lies between amino acids 36 and 168 Terminal 149 amino acids are both necessary and sufficient to recruit Swi6p *C-term 259 amino acids of Swi4p are necessary and sufficientfor interaction with Swi6p	SWI4
SWI5	.	YDR146C	Transcription factor for control of cell cycle-specific transcription of HO	Transmits signals for B cyclin kinase deactivation and the telophase to G1 transition in parallel with the Dbf2p pathway Swi5p-Sic1p pathway is dispensable but the Dbf2p-Dbf20p pathway is essential	Binds to DNA in cooperation with Pho2p	Interacts with Pho2p only in the presence of DNA	Contains three C2H2-type zinc fingers domains Nuclear localization sequence from amino acids 633 to 682 Residues 182-326 are needed to prevent daughter cell swtching Acidic domain between residues 470 and 503 contributes to promotion of transcription of the HO gene	SWI5
SWI6	SDS11 PSL8	YLR182W	Transcription factor that participates in the SFB complex (Swi4p-Swi6p)	Reqired for regulation at the cell cycle box (CCB) and in the MBF complex (Mbp1p-Swi6p) for regulation at the Mlu1 cellcycle box (MCB) SBF complex (Swi4p-Swi6p) controls transcription of HO, CLN1, CLN2, PCL1, and PCL2 *MBF (Swi6p-Mbp1p) binding to MluI sites is cooperative	Does not bind DNA directly	Binding of SBF complex (Swi4p-Swi6p) to SCB sequences occurs in the G1 phase of the cell cycle and is greatly reduced in G2 Interacts weakly with Clb2/Cdc28 kinase Swi4p and Swi6p associate through their C-termini Putative leucine zipper is not req. for interaction with Swi4p in vitro Activation of SBF complex (Swi4p-Swi6p) occurs at normal cell size in cln1 cln2 mutants CLN2 contains three versions of SCB (Swi4p-dependent cell-cycle box) bewteen -525 and -610 upstream of the predicted initiation codon which are bound by a Swi4p and Swi6p containing complex	Swi6p has a 21 amino acid leucine zipper from amino acids 585-606 Variously reported to have 2 or 4 ankyrin domains Ankyrin repeats are also called TPLH repeats, Cdc10-Swi6 repeats, notch repeats, and SWI6-ANK repeats 2 ankyrin repeats do not bind Clb2/Cdc28 kinase Ankyrin repeats may be targets for negative regulators *C terminus is req. for interaction with Swi4p and Mbp1p C-termini	SWI6
TAF17	TAF20 SLM7	YMR236W	Component of TAF(II) complex (TBP-associated protein complex) and the SAGA HAT complex	.	.		.	TAF17
TAF19	FUN81	YML098W	Component of TAF(II) complex (TBP-associated protein complex) and the SAGA HAT complex	.	.		.	TAF19
TAF25	TAF23	YDR167W	Component of TAF(II) complex (TBP-associated protein complex) and the SAGA complex	*Required for activated transcription by RNA polymerase II	.		.	TAF25
TAF30	ANC1 TFG3 SWP29 CST10	YPL129W	RNA polymerase II transcription initiation factor TFIIF (factor g), small subunit,	*Component of RNA polymerase holoenzyme, Kornberg's mediator (SRB) subcomplex, and the SWI-SNF complex	.		.	TAF30
TAF40	.	YML015C	Component of TAF(II) complex (TBP-associated factor	.	.		.	TAF40
TAF47	.	YPL011C	Component of the TAF(II) complex	.	.		.	TAF47
TAF48	MPT1 TSG2	YMR005W	Component of RNA polymerase II general transcription factor TFIID	.	.		.	TAF48
TAF60	.	YGL112C	Component of TAF(II) complex (TBP-associated protein complex) and the SAGA complex	*Required for activated transcription by RNA polymerase II	.		.	TAF60
TAF61	TAF68	YDR145W	Component of TAF(II) complex (TBP-associated protein complex) and the SAGA complex	*Required for activated transcription by RNA polymerase I	.	TBP-associated TAF[II] complex; SAGA transcriptional activator-histone acetyltransferase complex	.	TAF61
TAF65	.	YML114C	Component of RNA polymerase II general transcription factor TFIID	.	.		.	TAF65
TAF67	.	YMR227C	Component of the TAF(II) complex (TBP-associated factor),	*Required for activated transcription by RNA polymerase II	.		.	TAF67
TAF90	.	YBR198C	Component of TAF(II) complex (TBP-associated protein complex) and the SAGA complex	*Required for activated transcription by RNA polymerase II	.		Member of WD (WD-40) repeat family	TAF90
TAF145	TAF130	YGR274C	Component of TAF(II) complex (TBP-associated protein complex)	*Required for activated transcription by RNA polymerase II	.		.	TAF145
TAF150	TSM1	YCR042C	Component of TAF(II) complex (TBP-associated protein complex)	*Required for activated transcription by RNA polymerase II	.		.	TAF150
TBF1	TBFALPHA	YPL128C	Telomere binding protein TTAGGG repeat-binding factor	Postulated to serve as an anchor for telomerase	TTAGGG repeats Binds to TTAGGG sequence in the junction of subtelomeric X sequence and poly(G1-3A) Binding site usually located in a Y' or the STR-A element of the telomere *At least one binding site in each chromosome end	.	.	TBF1
TBP1	SPT15	YER148W	Component of RNA polymerases I, II, and III; part of initiation factors TFIID and TFIIIB	.	TATA boxes		.	TBP1
TEA1	.	YOR337W	Ty1 enhancer activator	.	Multiple CGGNxCGG sites or auxiliary regulatory proteins are req. for regulation, since ARG3 and ARGR3 genes with CGGN10CGG sequences are not regulated by Tea1p Binds to CGGNxCCG repeat in the Ty1 enhancer region which is a downstream regulatory element Binds to DNA at inverted CGG triplets spaced by 10 bp, resembling the binding site of Put3p and Cha4p	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain in the N-term region C-term region contains an acidic domain that can mediate transcriptional activation Multiple CGGNxCGG sequences *Dimerization motif in N-term region	TEA1
TEC1	ROC1	YBR083W	Transcriptional activator involved with STE12 in pseudohyphal formation	Req. for pseudohyphal growth Req. for full Ty1 expression and Ty1-mediated gene activation Transcriptional activator with STE12 of TY1 through sterile responsive element (SRE) which is just downstream of 5' LTR Acts downstream of STE11 and RAS2 Not involved in mating or sporulation Fus3p and Tec1p together are dispensable for filamentation and invasion, but individually they regulate haploid invasion	.	Functions with Ste12p to induce pseudohyphal growth, whereas without Tec1p Ste12p induces the mating phenotype Function of the sterile response element (SRE) in Ty1 is dependent on Ste12p and Tec1p	*Has no transcriptional activation domain	TEC1
TFA1	.	YKL028W	RNA polymerase II transcription initiation factor TFIIE (factor a), 66 kDa subunit	.	.		.	TFA1
TFA2	.	YKR062W	RNA polymerase II transcription initiation factor TFIIE (factor a), 43 kDa subunit	.	.		.	TFA2
TFB1	.	YDR311W	Component of RNA polymerase II transcription initiation factor TFIIH (factor b), 75 kDa subunit	.	.		.	TFB1
TFB2	LPH5	YPL122C	Component of RNA polymerase II transcription initiation TFIIH (factor b), 55 kDa subunit	.	.		.	TFB2
TFB3	RIG2	YDR460W	Component of RNA polymerase II transcription initiation TFIIH (factor b), 38 kDa subunit	.	.		.	TFB3
TFB4	.	YPR056W	RNA polymerase II transcription initiation factor TFIIH (factor b), 37 kDa subunit	.	.		.	TFB4
TFC1	.	YBR123C	RNA polymerase III transcription initiation factor TFIIIC (tau), 95 kDa subunit	.	.	.	.	TFC1
TFC3	TSV115	YAL001C	RNA polymerase III transcription initiation factor TFIIIC (tau), 138 kDa subunit	.	.	.	.	TFC3
TFC4	PCF1	YGR047C	RNA polymerase transcription III initiation factor TFIIIC (tau), 131 kDa subunit,	.	.	.	11 tetratricopeptide (TPR) repeats	TFC4
TFC5	.	YNL039W	Component of RNA polymerase III transcription factor TFIIIB, called B'' or TFIIIB90	.	.	.	.	TFC5
TFC6	.	YDR362C	RNA polymerase III transcription initiation factor TFIIIC (tau), 91-kDa subunit	.	.	.	.	TFC6
TFC7	.	YOR110W	RNA Polymerase III transcription initiation factor TFIIIC (tau), 55 kDa subunit	.	.	.	.	TFC7
TFC8	LPA10	YPL007C	RNA Polymerase III transcription initiation factor TFIIIC (tau), 60 kDa subunit	.	.	.	.	TFC8
TFG1	SSU71	YGR186W	RNA polymerase II transcription initiation factor TFIIF (factor g), 105 kDa subunit	.	.	Component of RNA polymerase holoenzyme complex	.	TFG1
TFG2	.	YGR005C	RNA polymerase II transcription initiation factor TFIIF (factor g); 54 kDa subunit	.	.	Component of RNA polymerase holoenzyme complex	.	TFG2
TFG3	ANC1	YPL129W	RNA polymerase II transcription initiation factor TFIIF (factor g), small subunit,	.	.	Component of RNA polymerase holoenzyme, Kornberg's mediator (SRB) subcomplex, and the SWI-SNF complex	.	TFG3
THI2	PHO6	YBR240C	Regulatory protein for thiamine pyrophosphokinase (THI80) expression	.	.	.	Zinc-finger protein	THI2
TIS11	CTH2	YLR136C	Protein of the inducible CCCH zinc finger family	.	.	.	.	TIS11
TOA1	.	YOR194C	RNA polymerase II transcription initiation factor TFIIA, large chain	.	.		.	TOA1
TOA2	.	YKL058W	RNA polymerase II transcription initiation factor TFIIA 13.5 kD subunit	.	.		.	TOA2
TSM1	TAF150 TAF(II)150	YCR042C	Component of TAF(II) complex (TBP-associated protein complex)	.	.	.	.	TSM1
TSP1	SUB1	YMR039C	Transcriptional coactivator	May be involved in the release of TFIIB from the transcription complex during transcription initiation Inhibits TBP-TFIIB-promoter complex formation (25739) enhances the activity of TFIIF Dephosphorylated recombinant Sub1p binds strongly to single-stranded DNA but less well to double-stranded DNA Dephosphorylated form interacts with TFIIB, whereas the phosphorylated form does not Dephosphorylation does not significantly affect the transcription stimulatory activity	Binds to single-stranded and double-stranded DNA	Interacts strongly with Sua7p but weakly with TATA-binding protein (TBP/Spt15p) in vitro	Contains a single-stranded DNA-binding motif 50% of amino acids are charged	TSP1
TUF1	.	.	.	.	YNNYYACCCG	.	.	TUF1
TUP1	SFL2 AER2 ROX4 CYC9 FLK1 UMR7 AMM1 (AAR1) CRT4/C	YCR084C	General repressor of transcription	(with Ssn6p), member of WD (WD-40) repeat family With Ssn6p regulates about 60 known genes including glucose regulation, oxygen stress response and DNA damage Genes whose expression is directly or indirectly repressed by Tup1p include those encoding hexose transporters, alpha-glucosidases, and mating pheromones, as well as DNA damage-inducible genes and genes involved in flocculation Involved in repression of heme-regulated and glucose-repressed genes Ssn6p-Tup1p complex represses DIT1 and DIT2 expression during vegetative growth Req. for alpha2 repression of a-specific genes Swi-Snf may antagonize Ssn6p-Tup1p by controlling chromatin remodeling activity Ssn6p-Tup1p complex is not req. for the establishment of nucleosome positioning at the SUC2 promoter in swi1 mutants Req. for repression of RME1 expression in a/alpha diploid cells *Req. for repression of haploid-specific genes and MATa-specific genes through its interaction with Alpha2p, but not req.. for proper donor selection during mating-type switching involved in maintenance of IME1 repression in haploid cells independently of Rme1p GET Results from microarray analysis	.	Interacts with Mig1p repressor, Rox1p repressor, and alpha2 repressor/Mcm1p Exists as a tetramer in the absence of Ssn6p Tup1p-Ssn6p complex is estimated to be 440 kDa in size, previously reported to be part of a complex of 1,200 kDa Tup1p-Ssn6p complex has about one Ssn6p and three Tup1p molecules Interaction with histones is relatively insensitive to ionic strength Single WD (WD-40) repeat is sufficient for binding to Alpha2p but all repeats are needed for specificity Interacts with Alpha2p through WD (WD-40) repeats Directly interacts with the N-term tails of underacetylated histone H3 and H4 Tup1p-Ssn6p complex can act directly on the SUC2 promoter even in the absence of the GC-box regions SUC2A and SUC2B DNA elements *Brought to target promoters by sequence-specific DNA-binding proteins such as Alpha2p-Mcm1p, Rox1p, Mig1p	WD-40 repeat containing protein with 7 C-term WD-40 repeats WD (WD-40) repeats serve different roles for repression of different regulons Polyglutamine runs in the N-term region N-term 200 amino acids of Tup1 are req. for partial repression of aerobic and catabolite repressed genes Histone-binding domain coincides with the repression domain First 72 amino acids are req.. for oligomerization and association with Ssn6p Mutations that specifically affect alpha2-mediated repression change amino acids conserved among Tup1 homologs from other yeasts, but not among WD (WD-40) proteins in general *Mutations that specifically affect alpha2-mediated repression changeamino acids that lie on one face of a predicted beta propeller formed by its WD (WD-40) repeats	TUP1
UGA3	.	YDL170W	Transcriptional activator for GABA catabolic genes	Regulates UGA4, UGA1, and UGS2 Not induced by oleate, Pip2p, or Oaf2p	.	.	Zn[2]-Cys[6] fungal-type binuclear cluster domain in N-term region Promoter contains a putative oleate response element, but it is probably not functional	UGA3
UME1	WTM3 LPI7	YPL139C	Negative regulator of meiosis	.	.	.	WD repeat-containing transcription modulator	UME1
UME6	CAR80 RIM16 NIM2 CARGR1 CARGRI	YDR207C	Negative transcriptional regulator involved in nitrogen repression and induction of meiosis	Negative regulator of most early meiotic genes and HSP82, INO1, FOX3, and CAR1 Involved in Ime1p-dependent induction of genes with URS1 (5'AGCCGCCGA3') promoter sequences Req. for negative regulation at sites that bind Rfa1p/ Rfa2p/ Rfa3p complex May be converted from a negative to a positive regulator by Ime1p Negatively regulates CAR1, inositol metabolism genes, several sporulation genes, and others Transcriptional repression may proceed by Ume6p binding to Sin3p, which then binds to Rpd3p, causing repression of transcription through core histone deacetylation Induction of Cho1p production does not involve Ime1p Represses Ino1p production through the URS1 promoter region Enhances basal level expression of PHR1 during the fermentative stage of cell growth Req. for glucose repression of POT1/FOX3 Req. for derepression of CHO1, CHO2, and OPI3 Req. for full expression of INO2 Req. for PHR1 induction in late exponential phase immediately preceding the diauxic shift Req. for Ime1p induction of IME2 *Glucose repression of ACS1 is partly controlled by a balance of the negative regulator Ume6p and the pleiotropic positive factor Abf1p	AGCCGCCA MSE: 5'HDVKNCACAAAAD	Transcriptional activation by Ume6p Requires Rim15p Transcriptional repression by Ume6p involves recruitment of a complex containing Sin3p and Rpd3p to target promoters Glucose or ammonia reduces interaction between Ume6p and Ime1p Interaction between Ume6p and Sin3p does not require Rpd3p *Requires Sin3p and Rpd3p histone deacetylase for the function of the Ume6p repression domain	Zn[2]-Cys[6] fungal-type binuclear cluster domain in the C-term region beginning at position 770 87 amino acid region, residues 508-594, is req. and sufficient to mediate the repression function *ATP/GTP-binding site motif A (P-loop)	UME6
WTM1	.	YOR230W	Transcriptional modulator involved in meiotic regulation and silencing	Represses target gene transcription when tethered to DNA * WTM genes negatively regulate silencing at HMR and telomere	.	Interacts with Wtm2p but not with Ume1p Part of a large complex	WD repeat-containing transcription modulator Localizes to the nucleus, but is not part of the nuclear pore complex *Protein abundance increases during meiosis	WTM1
WTM2	.	YOR229W	Transcriptional modulator involved in meiotic regulation and silencing	.	.	.	Member of WD (WD-40) repeat family Similar to WTM1	WTM2
XBP1	.	YIL101C	Stress-induced transcriptional repressor	Transcriptionally induced by heat shock, high osmolarity, oxidative stress, DNA damage, and glucose starvation Functions as transcriptional repressor when tethered to the LexA DNA-binding domain	GCCTCGA (G/A)G-(C/A)G (A/G)	.	*Binding sites exist in promoters of CCL1, YVH1, STV1, NAT1, ACH1, APM4, FHL1, RRN6, SSB1, FAB1, CCE1, RIB3, GND1, ILV3, SEC9, LIP5, ADE6, VAP1, CLN1, HOG1, REB1, STE50, MCM3, DOA4, YAR1, and HSP82	XBP1
YAP1	SNQ3 PAR1 (PDR4)	YML007W	Yeast activator protein of the basic leucine zipper (bZIP) family	Req. for activity of the stress response (STRE) element (CCCCT) but does not bind STRE directly Not involved in regulation from the heat shock element (HSE) Mutation in basic leucine zipper (bZIP) domain destroy DNA binding and function in cadmium resistance Not req..for superoxide induction of GSH1 Req. for hydrogen peroxide induction of SSA1 Req. for both the adaptive response and constitutive survival to malondialdehyde Transcriptional activity is inhibited by protein kinase A, whereas Gcn4ptranscription activity is stimulated by protein kinase A Rregulates levels of Sod1p, Zwf1p, Ycf1p, Trx2p, and Ttr1p Response of Yap1p to oxidative stress appears to involve a post-translational modification of the protein leading to increased binding to DNA Does not regulate TPS1, TPS2 or TPS3 Senses oxidative stress conditions generated by hydrogen peroxide and diamide differentially GET Results from microarray analysis	TTACTAA	.	DNA-binding site (TTACTAA) is different from AP-1 site (TGACTCA) Member of the jun family of basic leucine zipper (bZIP) transcriptional activators, which includes Yap1p and Cad1p Mammalian members of the jun family of basic leucine zipper (bZIP) transcriptional activators bind the AP-1 site (TGACTCA) N-term domain has similarity to the C-term DNA-binding domain of Gcn4p Three repeats of Cys-Ser-Glu at the C-term are req. for normal regulation of Yap1p function during oxidative stress *Overproduction increases transcriptional levels of 17 genes, including YAP1, ATR1, OYE2, OYE3, MDH2, FLR1, FRM2, ECM4, and genes withsimilarity to aryl-alcohol oxidoreductases or to dehydrogenases/oxidoreductases in general	YAP1
YAP2	CAD1	YDR423C	Yeast activator protein of the basic leucine zipper (bZIP) family, see CAD1	.	.	.	.	YAP2
YAP3	SNQ3 PAR1 (PDR4)	YML007W	Transcriptional activator of the basic leucine zipper (bZIP) family, involved in oxidative stress response	.	.	.	.	YAP3
YAP4	CIN5	YOR028C	Yeast activator protein of the basic leucine zipper (bZIP) family, see CIN5	.	.	.	.	YAP4
YAP5	.	YIR018W	Yeast activator protein of the basic leucine zipper (bZIP) family	.	.	.	.	YAP5
YAP6	.	YDR259C	Yeast activator protein of the basic leucine zipper (bZIP) family, involved in salt tolerance	.	TTACTAA	.	DNA-binding site (TTACTAA) is different from AP-1 site (TGACTCA)	YAP6
YAP7	.	YOL028C	Yeast activator protein of the basic leucine zipper (bZIP) family	.	.	.	.	YAP7
YAP8	ARR1	YPR199C	Yeast activator protein of the basic leucine zipper (bZIP) family, see ARR1	.	.	.	.	YAP8
ZAP1	.	YJL056C	Zinc-responsive transcriptional activator of zinc uptake system genes	Transcription is autoregulated in response to zinc	Binds to the ZRT1 promoter region in vitro	.	An N-term 706 amino acid region contains two potential acidic activation domains and contains 12% Cys and His residues C-term 174 amino acid region contains five C2H2 zinc finger domains of the TFIIIA type Consensus nuclear localization (NLS) sequence *Amino acid configuration has acidic regions similar to those of other transcription factors	ZAP1
ZDS1	NRC1 CES1 CKM1 OSS1	YMR273C	Regulator for SWE1 and CLN2 transcription, Sir3p phosphorylation, rDNA recombination and silencing, and life span	.	.	.	.	ZDS1
ZDS2	CES4	YML109W	Factor involved in regulation of transcriptional silencing and life span, multicopy suppressor of sin4	.	.	.	.	ZDS2